Incidental Mutation 'R9603:St18'
ID 723763
Institutional Source Beutler Lab
Gene Symbol St18
Ensembl Gene ENSMUSG00000033740
Gene Name suppression of tumorigenicity 18
Synonyms Nzf3, Myt3
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9603 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 6557455-6931164 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 6915811 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Arginine at position 819 (C819R)
Ref Sequence ENSEMBL: ENSMUSP00000042056 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043578] [ENSMUST00000131494] [ENSMUST00000140079] [ENSMUST00000150761] [ENSMUST00000151281] [ENSMUST00000163727]
AlphaFold Q80TY4
Predicted Effect probably damaging
Transcript: ENSMUST00000043578
AA Change: C819R

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000042056
Gene: ENSMUSG00000033740
AA Change: C819R

DomainStartEndE-ValueType
low complexity region 188 198 N/A INTRINSIC
Pfam:zf-C2HC 365 392 7.8e-15 PFAM
Pfam:zf-C2HC 409 437 4.2e-17 PFAM
Pfam:MYT1 476 713 1.3e-75 PFAM
Pfam:zf-C2HC 721 749 4e-19 PFAM
Pfam:zf-C2HC 765 793 1.7e-19 PFAM
Pfam:zf-C2HC 813 841 1.1e-17 PFAM
Pfam:zf-C2HC 866 893 9.1e-15 PFAM
coiled coil region 918 987 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000131494
AA Change: C819R

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000117789
Gene: ENSMUSG00000033740
AA Change: C819R

DomainStartEndE-ValueType
low complexity region 188 198 N/A INTRINSIC
Pfam:zf-C2HC 363 393 2.6e-17 PFAM
Pfam:zf-C2HC 407 437 1e-18 PFAM
Pfam:MYT1 476 714 1.5e-116 PFAM
Pfam:zf-C2HC 719 749 1e-19 PFAM
Pfam:zf-C2HC 763 793 1.3e-20 PFAM
Pfam:zf-C2HC 811 841 8.9e-19 PFAM
Pfam:zf-C2HC 864 894 1.3e-16 PFAM
coiled coil region 918 987 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000140079
AA Change: C819R

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000118322
Gene: ENSMUSG00000033740
AA Change: C819R

DomainStartEndE-ValueType
low complexity region 188 198 N/A INTRINSIC
Pfam:zf-C2HC 363 393 2.6e-17 PFAM
Pfam:zf-C2HC 407 437 1e-18 PFAM
Pfam:MYT1 476 714 1.5e-116 PFAM
Pfam:zf-C2HC 719 749 1e-19 PFAM
Pfam:zf-C2HC 763 793 1.3e-20 PFAM
Pfam:zf-C2HC 811 841 8.9e-19 PFAM
Pfam:zf-C2HC 864 894 1.3e-16 PFAM
coiled coil region 918 987 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000150761
AA Change: C819R

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000120298
Gene: ENSMUSG00000033740
AA Change: C819R

DomainStartEndE-ValueType
low complexity region 188 198 N/A INTRINSIC
Pfam:zf-C2HC 363 393 2.6e-17 PFAM
Pfam:zf-C2HC 407 437 1e-18 PFAM
Pfam:MYT1 476 714 1.5e-116 PFAM
Pfam:zf-C2HC 719 749 1e-19 PFAM
Pfam:zf-C2HC 763 793 1.3e-20 PFAM
Pfam:zf-C2HC 811 841 8.9e-19 PFAM
Pfam:zf-C2HC 864 894 1.3e-16 PFAM
coiled coil region 918 987 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000151281
AA Change: C819R

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000122055
Gene: ENSMUSG00000033740
AA Change: C819R

DomainStartEndE-ValueType
low complexity region 188 198 N/A INTRINSIC
Pfam:zf-C2HC 363 393 2.6e-17 PFAM
Pfam:zf-C2HC 407 437 1e-18 PFAM
Pfam:MYT1 476 714 1.5e-116 PFAM
Pfam:zf-C2HC 719 749 1e-19 PFAM
Pfam:zf-C2HC 763 793 1.3e-20 PFAM
Pfam:zf-C2HC 811 841 8.9e-19 PFAM
Pfam:zf-C2HC 864 894 1.3e-16 PFAM
coiled coil region 918 987 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000163727
AA Change: C819R

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000131417
Gene: ENSMUSG00000033740
AA Change: C819R

DomainStartEndE-ValueType
low complexity region 188 198 N/A INTRINSIC
Pfam:zf-C2HC 365 392 7.8e-15 PFAM
Pfam:zf-C2HC 409 437 4.2e-17 PFAM
Pfam:MYT1 476 713 1.3e-75 PFAM
Pfam:zf-C2HC 721 749 4e-19 PFAM
Pfam:zf-C2HC 765 793 1.7e-19 PFAM
Pfam:zf-C2HC 813 841 1.1e-17 PFAM
Pfam:zf-C2HC 866 893 9.1e-15 PFAM
coiled coil region 918 987 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl6 A T 11: 54,225,911 (GRCm39) N317I probably damaging Het
Adam18 T A 8: 25,118,147 (GRCm39) S590C possibly damaging Het
Btrc G A 19: 45,459,526 (GRCm39) E103K probably benign Het
Cars1 A G 7: 143,112,929 (GRCm39) M766T possibly damaging Het
Cavin4 T C 4: 48,671,999 (GRCm39) V148A probably benign Het
Cdcp3 T C 7: 130,830,643 (GRCm39) V359A probably damaging Het
Cdkn2d T C 9: 21,202,139 (GRCm39) D36G possibly damaging Het
Cubn A T 2: 13,292,510 (GRCm39) D3224E probably damaging Het
Ebf1 A G 11: 44,509,006 (GRCm39) M1V probably null Het
Eif1ad7 T G 12: 88,238,727 (GRCm39) N11T unknown Het
Fcgbp A G 7: 27,802,563 (GRCm39) D1497G probably damaging Het
Foxs1 A C 2: 152,774,281 (GRCm39) C257W probably damaging Het
Fstl5 C T 3: 76,496,260 (GRCm39) P341L probably damaging Het
Fzd10 G A 5: 128,678,771 (GRCm39) G164S probably benign Het
Hrh3 C A 2: 179,742,444 (GRCm39) E395* probably null Het
Hsf4 G A 8: 105,999,435 (GRCm39) V318M probably damaging Het
Il21 T C 3: 37,281,949 (GRCm39) E65G possibly damaging Het
Kank1 A G 19: 25,408,289 (GRCm39) D1256G possibly damaging Het
Klhl22 A G 16: 17,594,915 (GRCm39) N348S possibly damaging Het
Krr1 T C 10: 111,812,672 (GRCm39) I94T probably damaging Het
Lpin2 A G 17: 71,550,410 (GRCm39) D724G probably damaging Het
Mn1 C A 5: 111,566,393 (GRCm39) P121Q probably damaging Het
Mphosph9 A T 5: 124,463,015 (GRCm39) L10* probably null Het
Mtus1 A T 8: 41,536,795 (GRCm39) V307E probably benign Het
Muc20 A G 16: 32,615,155 (GRCm39) L74P probably damaging Het
Nnat A G 2: 157,403,701 (GRCm39) *113W probably null Het
Or13a25 G T 7: 140,247,794 (GRCm39) C191F probably damaging Het
Or2f1b C T 6: 42,739,672 (GRCm39) Q229* probably null Het
Or4f14 A G 2: 111,743,128 (GRCm39) V49A possibly damaging Het
Or6b6 A T 7: 106,571,103 (GRCm39) Y149* probably null Het
Pkm T A 9: 59,577,831 (GRCm39) V216E probably damaging Het
Pla2g12a G A 3: 129,674,900 (GRCm39) V19I unknown Het
Pramel27 T C 4: 143,578,267 (GRCm39) S176P Het
Rai14 G A 15: 10,595,116 (GRCm39) Q136* probably null Het
Rnf150 T A 8: 83,717,208 (GRCm39) N238K possibly damaging Het
Rrp1 A G 10: 78,240,757 (GRCm39) probably null Het
Scaf8 T A 17: 3,246,070 (GRCm39) L720M possibly damaging Het
Slamf1 G T 1: 171,625,771 (GRCm39) V316L probably damaging Het
Slc14a1 C A 18: 78,152,807 (GRCm39) A367S probably damaging Het
Slc25a20 T C 9: 108,549,675 (GRCm39) F86L probably benign Het
Slc4a5 T G 6: 83,217,714 (GRCm39) S131A probably benign Het
Slitrk3 A G 3: 72,958,649 (GRCm39) I41T probably benign Het
Sntg1 A T 1: 8,748,198 (GRCm39) L94Q probably damaging Het
St6galnac3 T A 3: 153,117,177 (GRCm39) D182V probably benign Het
Tubgcp2 T A 7: 139,584,789 (GRCm39) T549S probably benign Het
Vim A T 2: 13,579,148 (GRCm39) probably benign Het
Vmn2r118 C A 17: 55,899,837 (GRCm39) R689I probably damaging Het
Zbtb41 A T 1: 139,375,255 (GRCm39) E905V probably damaging Het
Zfyve9 A T 4: 108,499,288 (GRCm39) D1284E possibly damaging Het
Other mutations in St18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:St18 APN 1 6,872,796 (GRCm39) missense probably benign 0.07
IGL00840:St18 APN 1 6,903,818 (GRCm39) missense probably damaging 1.00
IGL01016:St18 APN 1 6,914,547 (GRCm39) missense probably damaging 0.98
IGL01116:St18 APN 1 6,872,856 (GRCm39) missense probably damaging 0.96
IGL01719:St18 APN 1 6,916,020 (GRCm39) splice site probably benign
IGL01885:St18 APN 1 6,914,596 (GRCm39) critical splice donor site probably null
IGL02486:St18 APN 1 6,890,307 (GRCm39) missense probably damaging 1.00
IGL02611:St18 APN 1 6,839,114 (GRCm39) splice site probably benign
IGL02742:St18 APN 1 6,872,540 (GRCm39) splice site probably benign
IGL02953:St18 APN 1 6,914,337 (GRCm39) splice site probably benign
IGL02999:St18 APN 1 6,887,829 (GRCm39) missense probably benign 0.01
IGL03092:St18 APN 1 6,839,118 (GRCm39) splice site probably benign
Smallish UTSW 1 6,925,697 (GRCm39) critical splice donor site probably null
IGL03055:St18 UTSW 1 6,872,959 (GRCm39) missense probably damaging 0.99
R0089:St18 UTSW 1 6,919,172 (GRCm39) missense probably benign 0.02
R0257:St18 UTSW 1 6,890,186 (GRCm39) missense probably benign 0.04
R0383:St18 UTSW 1 6,873,248 (GRCm39) missense probably damaging 1.00
R0588:St18 UTSW 1 6,887,962 (GRCm39) missense probably damaging 0.99
R0989:St18 UTSW 1 6,898,105 (GRCm39) missense probably benign 0.04
R1068:St18 UTSW 1 6,865,786 (GRCm39) missense probably benign 0.01
R1311:St18 UTSW 1 6,915,868 (GRCm39) missense probably damaging 1.00
R1530:St18 UTSW 1 6,915,793 (GRCm39) critical splice acceptor site probably null
R1723:St18 UTSW 1 6,880,909 (GRCm39) splice site probably benign
R1926:St18 UTSW 1 6,872,913 (GRCm39) missense probably benign 0.00
R1927:St18 UTSW 1 6,872,936 (GRCm39) missense probably benign 0.00
R2035:St18 UTSW 1 6,872,552 (GRCm39) missense probably benign 0.00
R2091:St18 UTSW 1 6,898,195 (GRCm39) missense probably benign 0.08
R2139:St18 UTSW 1 6,880,839 (GRCm39) missense possibly damaging 0.85
R2261:St18 UTSW 1 6,915,796 (GRCm39) missense probably damaging 0.96
R2300:St18 UTSW 1 6,925,626 (GRCm39) missense probably damaging 1.00
R2322:St18 UTSW 1 6,914,348 (GRCm39) nonsense probably null
R2846:St18 UTSW 1 6,915,811 (GRCm39) missense probably damaging 0.96
R3738:St18 UTSW 1 6,925,697 (GRCm39) critical splice donor site probably null
R3739:St18 UTSW 1 6,925,697 (GRCm39) critical splice donor site probably null
R3772:St18 UTSW 1 6,914,553 (GRCm39) missense probably damaging 1.00
R3805:St18 UTSW 1 6,872,577 (GRCm39) missense probably damaging 1.00
R3953:St18 UTSW 1 6,873,117 (GRCm39) missense probably damaging 0.99
R4034:St18 UTSW 1 6,925,697 (GRCm39) critical splice donor site probably null
R4036:St18 UTSW 1 6,898,010 (GRCm39) missense probably damaging 1.00
R4407:St18 UTSW 1 6,898,061 (GRCm39) missense probably benign 0.29
R4527:St18 UTSW 1 6,925,647 (GRCm39) missense probably damaging 1.00
R4740:St18 UTSW 1 6,887,828 (GRCm39) missense probably benign
R4838:St18 UTSW 1 6,873,129 (GRCm39) missense probably benign 0.01
R5182:St18 UTSW 1 6,887,877 (GRCm39) missense probably benign 0.03
R5186:St18 UTSW 1 6,872,541 (GRCm39) splice site probably null
R5354:St18 UTSW 1 6,914,395 (GRCm39) missense probably damaging 1.00
R5423:St18 UTSW 1 6,872,840 (GRCm39) missense possibly damaging 0.91
R5724:St18 UTSW 1 6,841,174 (GRCm39) missense probably benign 0.13
R6182:St18 UTSW 1 6,914,342 (GRCm39) splice site probably null
R6491:St18 UTSW 1 6,898,209 (GRCm39) nonsense probably null
R6503:St18 UTSW 1 6,865,621 (GRCm39) missense probably damaging 1.00
R7037:St18 UTSW 1 6,873,260 (GRCm39) missense possibly damaging 0.65
R7098:St18 UTSW 1 6,898,066 (GRCm39) missense probably damaging 1.00
R7132:St18 UTSW 1 6,929,351 (GRCm39) missense
R7144:St18 UTSW 1 6,903,818 (GRCm39) missense probably damaging 1.00
R7150:St18 UTSW 1 6,873,243 (GRCm39) missense probably damaging 1.00
R7334:St18 UTSW 1 6,872,783 (GRCm39) missense probably benign 0.00
R7502:St18 UTSW 1 6,898,194 (GRCm39) missense probably benign 0.09
R7729:St18 UTSW 1 6,872,761 (GRCm39) missense probably benign 0.00
R7848:St18 UTSW 1 6,927,669 (GRCm39) critical splice donor site probably null
R8088:St18 UTSW 1 6,898,229 (GRCm39) missense probably benign 0.00
R8299:St18 UTSW 1 6,873,216 (GRCm39) missense probably benign 0.01
R8338:St18 UTSW 1 6,879,516 (GRCm39) missense probably damaging 1.00
R8690:St18 UTSW 1 6,872,788 (GRCm39) missense probably benign
R8753:St18 UTSW 1 6,916,015 (GRCm39) missense probably damaging 1.00
R8808:St18 UTSW 1 6,880,826 (GRCm39) missense probably damaging 1.00
R8880:St18 UTSW 1 6,865,619 (GRCm39) nonsense probably null
R9055:St18 UTSW 1 6,873,206 (GRCm39) nonsense probably null
R9292:St18 UTSW 1 6,898,106 (GRCm39) missense probably benign 0.32
R9322:St18 UTSW 1 6,865,747 (GRCm39) missense probably benign 0.00
R9530:St18 UTSW 1 6,872,997 (GRCm39) missense probably benign 0.00
R9611:St18 UTSW 1 6,873,147 (GRCm39) missense probably benign 0.00
R9639:St18 UTSW 1 6,929,246 (GRCm39) missense
R9644:St18 UTSW 1 6,929,276 (GRCm39) missense
R9740:St18 UTSW 1 6,873,287 (GRCm39) nonsense probably null
R9750:St18 UTSW 1 6,873,216 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGTCTGCCAGCTCTTACCAAC -3'
(R):5'- AGACCATTGCATCCTGGCAG -3'

Sequencing Primer
(F):5'- CAGAGTGGTCCTACCTACATTGG -3'
(R):5'- CAGAGGACAGTGAGGAAGCTCTTG -3'
Posted On 2022-09-12