Incidental Mutation 'R9603:Olfr1306'
ID 723769
Institutional Source Beutler Lab
Gene Symbol Olfr1306
Ensembl Gene ENSMUSG00000096566
Gene Name olfactory receptor 1306
Synonyms GA_x6K02T2Q125-72954873-72953935, MOR245-15
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.157) question?
Stock # R9603 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 111911264-111916271 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 111912783 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 49 (V49A)
Ref Sequence ENSEMBL: ENSMUSP00000151142 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099607] [ENSMUST00000214844]
AlphaFold A2BFL7
Predicted Effect possibly damaging
Transcript: ENSMUST00000099607
AA Change: V49A

PolyPhen 2 Score 0.686 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000097202
Gene: ENSMUSG00000096566
AA Change: V49A

DomainStartEndE-ValueType
Pfam:7tm_4 30 305 4.7e-43 PFAM
Pfam:7tm_1 41 287 9.7e-25 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000214844
AA Change: V49A

PolyPhen 2 Score 0.686 (Sensitivity: 0.86; Specificity: 0.92)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik T C 7: 131,228,914 V359A probably damaging Het
Acsl6 A T 11: 54,335,085 N317I probably damaging Het
Adam18 T A 8: 24,628,131 S590C possibly damaging Het
Btrc G A 19: 45,471,087 E103K probably benign Het
Cars A G 7: 143,559,192 M766T possibly damaging Het
Cavin4 T C 4: 48,671,999 V148A probably benign Het
Cdkn2d T C 9: 21,290,843 D36G possibly damaging Het
Cubn A T 2: 13,287,699 D3224E probably damaging Het
Ebf1 A G 11: 44,618,179 M1V probably null Het
Fcgbp A G 7: 28,103,138 D1497G probably damaging Het
Foxs1 A C 2: 152,932,361 C257W probably damaging Het
Fstl5 C T 3: 76,588,953 P341L probably damaging Het
Fzd10 G A 5: 128,601,707 G164S probably benign Het
Gm13103 T C 4: 143,851,697 S176P Het
Gm5662 T G 12: 88,271,957 N11T unknown Het
Hrh3 C A 2: 180,100,651 E395* probably null Het
Hsf4 G A 8: 105,272,803 V318M probably damaging Het
Il21 T C 3: 37,227,800 E65G possibly damaging Het
Kank1 A G 19: 25,430,925 D1256G possibly damaging Het
Klhl22 A G 16: 17,777,051 N348S possibly damaging Het
Krr1 T C 10: 111,976,767 I94T probably damaging Het
Lpin2 A G 17: 71,243,415 D724G probably damaging Het
Mn1 C A 5: 111,418,527 P121Q probably damaging Het
Mphosph9 A T 5: 124,324,952 L10* probably null Het
Mtus1 A T 8: 41,083,758 V307E probably benign Het
Muc20 A G 16: 32,794,785 L74P probably damaging Het
Nnat A G 2: 157,561,781 *113W probably null Het
Olfr38 C T 6: 42,762,738 Q229* probably null Het
Olfr539 G T 7: 140,667,881 C191F probably damaging Het
Olfr711 A T 7: 106,971,896 Y149* probably null Het
Pkm T A 9: 59,670,548 V216E probably damaging Het
Pla2g12a G A 3: 129,881,251 V19I unknown Het
Rai14 G A 15: 10,595,030 Q136* probably null Het
Rnf150 T A 8: 82,990,579 N238K possibly damaging Het
Rrp1 A G 10: 78,404,923 probably null Het
Scaf8 T A 17: 3,195,795 L720M possibly damaging Het
Slamf1 G T 1: 171,798,203 V316L probably damaging Het
Slc14a1 C A 18: 78,109,592 A367S probably damaging Het
Slc25a20 T C 9: 108,672,476 F86L probably benign Het
Slc4a5 T G 6: 83,240,732 S131A probably benign Het
Slitrk3 A G 3: 73,051,316 I41T probably benign Het
Sntg1 A T 1: 8,677,974 L94Q probably damaging Het
St18 T C 1: 6,845,587 C819R probably damaging Het
St6galnac3 T A 3: 153,411,540 D182V probably benign Het
Tubgcp2 T A 7: 140,004,876 T549S probably benign Het
Vim A T 2: 13,574,337 probably benign Het
Vmn2r118 C A 17: 55,592,837 R689I probably damaging Het
Zbtb41 A T 1: 139,447,517 E905V probably damaging Het
Zfyve9 A T 4: 108,642,091 D1284E possibly damaging Het
Other mutations in Olfr1306
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Olfr1306 APN 2 111912036 missense possibly damaging 0.95
IGL01310:Olfr1306 APN 2 111912307 missense probably benign 0.34
IGL01893:Olfr1306 APN 2 111912244 missense possibly damaging 0.65
IGL02433:Olfr1306 APN 2 111912417 missense probably damaging 1.00
IGL03302:Olfr1306 APN 2 111912822 missense possibly damaging 0.61
R0544:Olfr1306 UTSW 2 111912560 nonsense probably null
R0674:Olfr1306 UTSW 2 111912673 missense probably benign 0.41
R1118:Olfr1306 UTSW 2 111912877 missense probably benign 0.02
R1764:Olfr1306 UTSW 2 111912181 missense possibly damaging 0.93
R2915:Olfr1306 UTSW 2 111912719 missense probably damaging 1.00
R3976:Olfr1306 UTSW 2 111912606 missense possibly damaging 0.84
R4855:Olfr1306 UTSW 2 111912099 missense probably benign 0.41
R6475:Olfr1306 UTSW 2 111912859 nonsense probably null
R6513:Olfr1306 UTSW 2 111912883 missense possibly damaging 0.89
R6536:Olfr1306 UTSW 2 111912774 missense possibly damaging 0.94
R6748:Olfr1306 UTSW 2 111912357 missense possibly damaging 0.47
R6843:Olfr1306 UTSW 2 111912915 missense probably damaging 1.00
R7006:Olfr1306 UTSW 2 111912256 missense probably benign 0.16
R7169:Olfr1306 UTSW 2 111912594 missense possibly damaging 0.95
R7230:Olfr1306 UTSW 2 111912561 missense probably damaging 1.00
R7419:Olfr1306 UTSW 2 111912090 missense probably damaging 1.00
R7448:Olfr1306 UTSW 2 111912292 missense probably benign 0.00
R7753:Olfr1306 UTSW 2 111912582 missense probably benign 0.06
R7761:Olfr1306 UTSW 2 111912877 missense probably benign 0.02
R8330:Olfr1306 UTSW 2 111912379 missense probably benign 0.00
R8497:Olfr1306 UTSW 2 111912619 missense possibly damaging 0.82
R8942:Olfr1306 UTSW 2 111912862 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- CAAAGGCCATGGCTATGAGC -3'
(R):5'- TCTGATTACTACTAGTGCTCAGC -3'

Sequencing Primer
(F):5'- GCTATGAGCAGCACCATCTC -3'
(R):5'- TCCTTCCTCCTTCAGGCAG -3'
Posted On 2022-09-12