Incidental Mutation 'R9603:Hrh3'
ID 723772
Institutional Source Beutler Lab
Gene Symbol Hrh3
Ensembl Gene ENSMUSG00000039059
Gene Name histamine receptor H3
Synonyms Eae8
MMRRC Submission
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.333) question?
Stock # R9603 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 179741258-179746264 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) C to A at 179742444 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 395 (E395*)
Ref Sequence ENSEMBL: ENSMUSP00000049963 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056480] [ENSMUST00000163215] [ENSMUST00000164442] [ENSMUST00000165248] [ENSMUST00000165762] [ENSMUST00000166724] [ENSMUST00000171736]
AlphaFold P58406
Predicted Effect probably null
Transcript: ENSMUST00000056480
AA Change: E395*
SMART Domains Protein: ENSMUSP00000049963
Gene: ENSMUSG00000039059
AA Change: E395*

DomainStartEndE-ValueType
low complexity region 12 50 N/A INTRINSIC
Pfam:7tm_1 51 412 7.2e-65 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163215
SMART Domains Protein: ENSMUSP00000127053
Gene: ENSMUSG00000039059

DomainStartEndE-ValueType
low complexity region 12 50 N/A INTRINSIC
Pfam:7tm_1 51 376 2e-55 PFAM
low complexity region 406 415 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000164442
AA Change: E363*
SMART Domains Protein: ENSMUSP00000130553
Gene: ENSMUSG00000039059
AA Change: E363*

DomainStartEndE-ValueType
low complexity region 12 50 N/A INTRINSIC
Pfam:7tm_1 51 380 4.8e-65 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000165248
AA Change: E347*
SMART Domains Protein: ENSMUSP00000130181
Gene: ENSMUSG00000039059
AA Change: E347*

DomainStartEndE-ValueType
low complexity region 12 50 N/A INTRINSIC
Pfam:7tm_1 51 364 6.9e-65 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000165762
AA Change: E395*
SMART Domains Protein: ENSMUSP00000132203
Gene: ENSMUSG00000039059
AA Change: E395*

DomainStartEndE-ValueType
low complexity region 12 50 N/A INTRINSIC
Pfam:7tm_1 51 412 1.3e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166724
SMART Domains Protein: ENSMUSP00000126336
Gene: ENSMUSG00000039059

DomainStartEndE-ValueType
low complexity region 12 50 N/A INTRINSIC
Pfam:7tm_1 51 93 1.8e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171736
SMART Domains Protein: ENSMUSP00000127085
Gene: ENSMUSG00000039059

DomainStartEndE-ValueType
low complexity region 12 50 N/A INTRINSIC
Pfam:7tm_1 51 239 5.2e-45 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Histamine is a ubiquitous messenger molecule released from mast cells, enterochromaffin-like cells, and neurons. Its various actions are mediated by histamine receptors H1, H2, H3 and H4. This gene encodes one of the histamine receptors (H3) which belongs to the family 1 of G protein-coupled receptors. It is an integral membrane protein and can regulate neurotransmitter release. This receptor can also increase voltage-dependent calcium current in smooth muscles and innervates the blood vessels and the heart in cardiovascular system. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit reduced locomotor activity and body temperature, and attenuated behavioral responses to the drugs thioperamide, methamphetamine, and scopolamine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl6 A T 11: 54,225,911 (GRCm39) N317I probably damaging Het
Adam18 T A 8: 25,118,147 (GRCm39) S590C possibly damaging Het
Btrc G A 19: 45,459,526 (GRCm39) E103K probably benign Het
Cars1 A G 7: 143,112,929 (GRCm39) M766T possibly damaging Het
Cavin4 T C 4: 48,671,999 (GRCm39) V148A probably benign Het
Cdcp3 T C 7: 130,830,643 (GRCm39) V359A probably damaging Het
Cdkn2d T C 9: 21,202,139 (GRCm39) D36G possibly damaging Het
Cubn A T 2: 13,292,510 (GRCm39) D3224E probably damaging Het
Ebf1 A G 11: 44,509,006 (GRCm39) M1V probably null Het
Eif1ad7 T G 12: 88,238,727 (GRCm39) N11T unknown Het
Fcgbp A G 7: 27,802,563 (GRCm39) D1497G probably damaging Het
Foxs1 A C 2: 152,774,281 (GRCm39) C257W probably damaging Het
Fstl5 C T 3: 76,496,260 (GRCm39) P341L probably damaging Het
Fzd10 G A 5: 128,678,771 (GRCm39) G164S probably benign Het
Hsf4 G A 8: 105,999,435 (GRCm39) V318M probably damaging Het
Il21 T C 3: 37,281,949 (GRCm39) E65G possibly damaging Het
Kank1 A G 19: 25,408,289 (GRCm39) D1256G possibly damaging Het
Klhl22 A G 16: 17,594,915 (GRCm39) N348S possibly damaging Het
Krr1 T C 10: 111,812,672 (GRCm39) I94T probably damaging Het
Lpin2 A G 17: 71,550,410 (GRCm39) D724G probably damaging Het
Mn1 C A 5: 111,566,393 (GRCm39) P121Q probably damaging Het
Mphosph9 A T 5: 124,463,015 (GRCm39) L10* probably null Het
Mtus1 A T 8: 41,536,795 (GRCm39) V307E probably benign Het
Muc20 A G 16: 32,615,155 (GRCm39) L74P probably damaging Het
Nnat A G 2: 157,403,701 (GRCm39) *113W probably null Het
Or13a25 G T 7: 140,247,794 (GRCm39) C191F probably damaging Het
Or2f1b C T 6: 42,739,672 (GRCm39) Q229* probably null Het
Or4f14 A G 2: 111,743,128 (GRCm39) V49A possibly damaging Het
Or6b6 A T 7: 106,571,103 (GRCm39) Y149* probably null Het
Pkm T A 9: 59,577,831 (GRCm39) V216E probably damaging Het
Pla2g12a G A 3: 129,674,900 (GRCm39) V19I unknown Het
Pramel27 T C 4: 143,578,267 (GRCm39) S176P Het
Rai14 G A 15: 10,595,116 (GRCm39) Q136* probably null Het
Rnf150 T A 8: 83,717,208 (GRCm39) N238K possibly damaging Het
Rrp1 A G 10: 78,240,757 (GRCm39) probably null Het
Scaf8 T A 17: 3,246,070 (GRCm39) L720M possibly damaging Het
Slamf1 G T 1: 171,625,771 (GRCm39) V316L probably damaging Het
Slc14a1 C A 18: 78,152,807 (GRCm39) A367S probably damaging Het
Slc25a20 T C 9: 108,549,675 (GRCm39) F86L probably benign Het
Slc4a5 T G 6: 83,217,714 (GRCm39) S131A probably benign Het
Slitrk3 A G 3: 72,958,649 (GRCm39) I41T probably benign Het
Sntg1 A T 1: 8,748,198 (GRCm39) L94Q probably damaging Het
St18 T C 1: 6,915,811 (GRCm39) C819R probably damaging Het
St6galnac3 T A 3: 153,117,177 (GRCm39) D182V probably benign Het
Tubgcp2 T A 7: 139,584,789 (GRCm39) T549S probably benign Het
Vim A T 2: 13,579,148 (GRCm39) probably benign Het
Vmn2r118 C A 17: 55,899,837 (GRCm39) R689I probably damaging Het
Zbtb41 A T 1: 139,375,255 (GRCm39) E905V probably damaging Het
Zfyve9 A T 4: 108,499,288 (GRCm39) D1284E possibly damaging Het
Other mutations in Hrh3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01652:Hrh3 APN 2 179,742,896 (GRCm39) missense possibly damaging 0.69
IGL01827:Hrh3 APN 2 179,745,739 (GRCm39) missense possibly damaging 0.95
IGL01912:Hrh3 APN 2 179,743,169 (GRCm39) missense probably damaging 1.00
IGL02992:Hrh3 APN 2 179,742,608 (GRCm39) missense probably benign 0.11
IGL03273:Hrh3 APN 2 179,742,441 (GRCm39) missense possibly damaging 0.85
R1403:Hrh3 UTSW 2 179,744,547 (GRCm39) missense probably damaging 1.00
R1403:Hrh3 UTSW 2 179,744,547 (GRCm39) missense probably damaging 1.00
R1808:Hrh3 UTSW 2 179,741,577 (GRCm39) unclassified probably benign
R2060:Hrh3 UTSW 2 179,743,043 (GRCm39) missense possibly damaging 0.95
R4110:Hrh3 UTSW 2 179,744,643 (GRCm39) missense possibly damaging 0.84
R4111:Hrh3 UTSW 2 179,744,643 (GRCm39) missense possibly damaging 0.84
R4113:Hrh3 UTSW 2 179,744,643 (GRCm39) missense possibly damaging 0.84
R4330:Hrh3 UTSW 2 179,741,665 (GRCm39) unclassified probably benign
R4935:Hrh3 UTSW 2 179,743,061 (GRCm39) missense probably damaging 1.00
R5050:Hrh3 UTSW 2 179,742,350 (GRCm39) missense probably damaging 1.00
R5543:Hrh3 UTSW 2 179,745,763 (GRCm39) missense probably damaging 0.99
R5780:Hrh3 UTSW 2 179,742,608 (GRCm39) missense probably damaging 0.96
R7571:Hrh3 UTSW 2 179,743,079 (GRCm39) missense probably damaging 0.98
R8699:Hrh3 UTSW 2 179,743,149 (GRCm39) missense probably damaging 0.99
R9698:Hrh3 UTSW 2 179,743,206 (GRCm39) missense possibly damaging 0.59
Predicted Primers PCR Primer
(F):5'- TCAGAACAGGTACAAGGGCC -3'
(R):5'- GTCTTCAGCGTCCTTGGAGAAG -3'

Sequencing Primer
(F):5'- CTGGCCGTAGAAGGGTGG -3'
(R):5'- GCGCATGAAGATGGTATCCC -3'
Posted On 2022-09-12