Incidental Mutation 'R9603:Cavin4'
ID 723778
Institutional Source Beutler Lab
Gene Symbol Cavin4
Ensembl Gene ENSMUSG00000028348
Gene Name caveolae associated 4
Synonyms cavin 4, Murc, 2310039E09Rik
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9603 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 48663514-48673492 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 48671999 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 148 (V148A)
Ref Sequence ENSEMBL: ENSMUSP00000030033 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030033]
AlphaFold A2AMM0
Predicted Effect probably benign
Transcript: ENSMUST00000030033
AA Change: V148A

PolyPhen 2 Score 0.099 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000030033
Gene: ENSMUSG00000028348
AA Change: V148A

DomainStartEndE-ValueType
Pfam:PTRF_SDPR 27 263 7.8e-92 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing two coiled-coil regions. The encoded protein promotes Rho/ROCK (Rho-kinase) signaling in cardiac muscles cells, and may facilitate myofibrillar organization. [provided by RefSeq, Jun 2013]
PHENOTYPE: Homozygous null mice are viable and fertile with normal cardiac mass and function under physiological conditions. Phenylephrine-induced cardiac hypertrophy is suppressed in null mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl6 A T 11: 54,225,911 (GRCm39) N317I probably damaging Het
Adam18 T A 8: 25,118,147 (GRCm39) S590C possibly damaging Het
Btrc G A 19: 45,459,526 (GRCm39) E103K probably benign Het
Cars1 A G 7: 143,112,929 (GRCm39) M766T possibly damaging Het
Cdcp3 T C 7: 130,830,643 (GRCm39) V359A probably damaging Het
Cdkn2d T C 9: 21,202,139 (GRCm39) D36G possibly damaging Het
Cubn A T 2: 13,292,510 (GRCm39) D3224E probably damaging Het
Ebf1 A G 11: 44,509,006 (GRCm39) M1V probably null Het
Eif1ad7 T G 12: 88,238,727 (GRCm39) N11T unknown Het
Fcgbp A G 7: 27,802,563 (GRCm39) D1497G probably damaging Het
Foxs1 A C 2: 152,774,281 (GRCm39) C257W probably damaging Het
Fstl5 C T 3: 76,496,260 (GRCm39) P341L probably damaging Het
Fzd10 G A 5: 128,678,771 (GRCm39) G164S probably benign Het
Hrh3 C A 2: 179,742,444 (GRCm39) E395* probably null Het
Hsf4 G A 8: 105,999,435 (GRCm39) V318M probably damaging Het
Il21 T C 3: 37,281,949 (GRCm39) E65G possibly damaging Het
Kank1 A G 19: 25,408,289 (GRCm39) D1256G possibly damaging Het
Klhl22 A G 16: 17,594,915 (GRCm39) N348S possibly damaging Het
Krr1 T C 10: 111,812,672 (GRCm39) I94T probably damaging Het
Lpin2 A G 17: 71,550,410 (GRCm39) D724G probably damaging Het
Mn1 C A 5: 111,566,393 (GRCm39) P121Q probably damaging Het
Mphosph9 A T 5: 124,463,015 (GRCm39) L10* probably null Het
Mtus1 A T 8: 41,536,795 (GRCm39) V307E probably benign Het
Muc20 A G 16: 32,615,155 (GRCm39) L74P probably damaging Het
Nnat A G 2: 157,403,701 (GRCm39) *113W probably null Het
Or13a25 G T 7: 140,247,794 (GRCm39) C191F probably damaging Het
Or2f1b C T 6: 42,739,672 (GRCm39) Q229* probably null Het
Or4f14 A G 2: 111,743,128 (GRCm39) V49A possibly damaging Het
Or6b6 A T 7: 106,571,103 (GRCm39) Y149* probably null Het
Pkm T A 9: 59,577,831 (GRCm39) V216E probably damaging Het
Pla2g12a G A 3: 129,674,900 (GRCm39) V19I unknown Het
Pramel27 T C 4: 143,578,267 (GRCm39) S176P Het
Rai14 G A 15: 10,595,116 (GRCm39) Q136* probably null Het
Rnf150 T A 8: 83,717,208 (GRCm39) N238K possibly damaging Het
Rrp1 A G 10: 78,240,757 (GRCm39) probably null Het
Scaf8 T A 17: 3,246,070 (GRCm39) L720M possibly damaging Het
Slamf1 G T 1: 171,625,771 (GRCm39) V316L probably damaging Het
Slc14a1 C A 18: 78,152,807 (GRCm39) A367S probably damaging Het
Slc25a20 T C 9: 108,549,675 (GRCm39) F86L probably benign Het
Slc4a5 T G 6: 83,217,714 (GRCm39) S131A probably benign Het
Slitrk3 A G 3: 72,958,649 (GRCm39) I41T probably benign Het
Sntg1 A T 1: 8,748,198 (GRCm39) L94Q probably damaging Het
St18 T C 1: 6,915,811 (GRCm39) C819R probably damaging Het
St6galnac3 T A 3: 153,117,177 (GRCm39) D182V probably benign Het
Tubgcp2 T A 7: 139,584,789 (GRCm39) T549S probably benign Het
Vim A T 2: 13,579,148 (GRCm39) probably benign Het
Vmn2r118 C A 17: 55,899,837 (GRCm39) R689I probably damaging Het
Zbtb41 A T 1: 139,375,255 (GRCm39) E905V probably damaging Het
Zfyve9 A T 4: 108,499,288 (GRCm39) D1284E possibly damaging Het
Other mutations in Cavin4
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1127:Cavin4 UTSW 4 48,663,637 (GRCm39) missense probably damaging 1.00
R1298:Cavin4 UTSW 4 48,672,593 (GRCm39) missense probably benign 0.02
R5389:Cavin4 UTSW 4 48,663,907 (GRCm39) missense probably damaging 1.00
R5668:Cavin4 UTSW 4 48,672,499 (GRCm39) missense probably benign
R5827:Cavin4 UTSW 4 48,672,074 (GRCm39) missense probably damaging 1.00
R6145:Cavin4 UTSW 4 48,663,794 (GRCm39) missense probably damaging 1.00
R6180:Cavin4 UTSW 4 48,663,917 (GRCm39) missense possibly damaging 0.95
R6334:Cavin4 UTSW 4 48,663,824 (GRCm39) missense possibly damaging 0.77
R6861:Cavin4 UTSW 4 48,672,214 (GRCm39) missense probably benign 0.25
R7038:Cavin4 UTSW 4 48,672,479 (GRCm39) missense probably benign 0.25
R7378:Cavin4 UTSW 4 48,663,631 (GRCm39) missense probably benign 0.24
R7718:Cavin4 UTSW 4 48,671,984 (GRCm39) missense probably benign 0.14
R8909:Cavin4 UTSW 4 48,672,421 (GRCm39) missense probably benign 0.25
R9548:Cavin4 UTSW 4 48,663,956 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTGAGAGGTGCCTGTGCTATAG -3'
(R):5'- AAGAGTCTGCCGTGTCTTCTG -3'

Sequencing Primer
(F):5'- CCTGTGCTATAGTTAGAGGGAGAAG -3'
(R):5'- CGTGTCTTCTGCATGTTTTCTCTGG -3'
Posted On 2022-09-12