Mutagenetix > Incidental Mutation

Incidental Mutation 'R9603:Zfyve9'

723779

Institutional Source

Beutler Lab

Gene Symbol

Zfyve9

Ensembl Gene

ENSMUSG00000034557

Gene Name

zinc finger, FYVE domain containing 9

Synonyms

Madhip

MMRRC Submission

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.456) question?

Stock #

R9603 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

108637466-108780798 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 108642091 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 1284 (D1284E)

Ref Sequence

ENSEMBL: ENSMUSP00000102269 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000042185] [ENSMUST00000106657] [ENSMUST00000106658]

AlphaFold

A2A8R0

Predicted Effect

probably benign
Transcript: ENSMUST00000042185
AA Change: D652E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000039852
Gene: ENSMUSG00000034557
AA Change: D652E

Domain	Start	End	E-Value	Type
Blast:FYVE	7	40	4e-7	BLAST
Pfam:SARA	52	92	1e-25	PFAM
Pfam:DUF3480	328	681	1.4e-189	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000106657
AA Change: D1343E

PolyPhen 2 Score 0.710 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000102268
Gene: ENSMUSG00000034557
AA Change: D1343E

Domain	Start	End	E-Value	Type
low complexity region	230	243	N/A	INTRINSIC
low complexity region	471	487	N/A	INTRINSIC
low complexity region	578	587	N/A	INTRINSIC
Blast:FYVE	590	618	7e-6	BLAST
FYVE	663	731	2.38e-26	SMART
Pfam:SARA	745	783	1.3e-22	PFAM
Pfam:DUF3480	1020	1372	1e-178	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000106658
AA Change: D1284E

PolyPhen 2 Score 0.837 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000102269
Gene: ENSMUSG00000034557
AA Change: D1284E

Domain	Start	End	E-Value	Type
low complexity region	230	243	N/A	INTRINSIC
low complexity region	471	487	N/A	INTRINSIC
low complexity region	578	587	N/A	INTRINSIC
Blast:FYVE	590	618	8e-6	BLAST
FYVE	663	731	2.38e-26	SMART
Pfam:DUF3480	960	1313	5.5e-189	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a double zinc finger motif-containing protein that participates in the transforming growth factor-beta (TGFB) signalling pathway. The encoded protein interacts directly with SMAD2 and SMAD3, and recruits SMAD2 to the TGFB receptor. There are multiple pseudogenes for this gene on chromosomes 2, 15, and X. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2013]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5430419D17Rik	T	C	7: 131,228,914	V359A	probably damaging	Het
Acsl6	A	T	11: 54,335,085	N317I	probably damaging	Het
Adam18	T	A	8: 24,628,131	S590C	possibly damaging	Het
Btrc	G	A	19: 45,471,087	E103K	probably benign	Het
Cars	A	G	7: 143,559,192	M766T	possibly damaging	Het
Cavin4	T	C	4: 48,671,999	V148A	probably benign	Het
Cdkn2d	T	C	9: 21,290,843	D36G	possibly damaging	Het
Cubn	A	T	2: 13,287,699	D3224E	probably damaging	Het
Ebf1	A	G	11: 44,618,179	M1V	probably null	Het
Fcgbp	A	G	7: 28,103,138	D1497G	probably damaging	Het
Foxs1	A	C	2: 152,932,361	C257W	probably damaging	Het
Fstl5	C	T	3: 76,588,953	P341L	probably damaging	Het
Fzd10	G	A	5: 128,601,707	G164S	probably benign	Het
Gm13103	T	C	4: 143,851,697	S176P		Het
Gm5662	T	G	12: 88,271,957	N11T	unknown	Het
Hrh3	C	A	2: 180,100,651	E395*	probably null	Het
Hsf4	G	A	8: 105,272,803	V318M	probably damaging	Het
Il21	T	C	3: 37,227,800	E65G	possibly damaging	Het
Kank1	A	G	19: 25,430,925	D1256G	possibly damaging	Het
Klhl22	A	G	16: 17,777,051	N348S	possibly damaging	Het
Krr1	T	C	10: 111,976,767	I94T	probably damaging	Het
Lpin2	A	G	17: 71,243,415	D724G	probably damaging	Het
Mn1	C	A	5: 111,418,527	P121Q	probably damaging	Het
Mphosph9	A	T	5: 124,324,952	L10*	probably null	Het
Mtus1	A	T	8: 41,083,758	V307E	probably benign	Het
Muc20	A	G	16: 32,794,785	L74P	probably damaging	Het
Nnat	A	G	2: 157,561,781	*113W	probably null	Het
Olfr1306	A	G	2: 111,912,783	V49A	possibly damaging	Het
Olfr38	C	T	6: 42,762,738	Q229*	probably null	Het
Olfr539	G	T	7: 140,667,881	C191F	probably damaging	Het
Olfr711	A	T	7: 106,971,896	Y149*	probably null	Het
Pkm	T	A	9: 59,670,548	V216E	probably damaging	Het
Pla2g12a	G	A	3: 129,881,251	V19I	unknown	Het
Rai14	G	A	15: 10,595,030	Q136*	probably null	Het
Rnf150	T	A	8: 82,990,579	N238K	possibly damaging	Het
Rrp1	A	G	10: 78,404,923		probably null	Het
Scaf8	T	A	17: 3,195,795	L720M	possibly damaging	Het
Slamf1	G	T	1: 171,798,203	V316L	probably damaging	Het
Slc14a1	C	A	18: 78,109,592	A367S	probably damaging	Het
Slc25a20	T	C	9: 108,672,476	F86L	probably benign	Het
Slc4a5	T	G	6: 83,240,732	S131A	probably benign	Het
Slitrk3	A	G	3: 73,051,316	I41T	probably benign	Het
Sntg1	A	T	1: 8,677,974	L94Q	probably damaging	Het
St18	T	C	1: 6,845,587	C819R	probably damaging	Het
St6galnac3	T	A	3: 153,411,540	D182V	probably benign	Het
Tubgcp2	T	A	7: 140,004,876	T549S	probably benign	Het
Vim	A	T	2: 13,574,337		probably benign	Het
Vmn2r118	C	A	17: 55,592,837	R689I	probably damaging	Het
Zbtb41	A	T	1: 139,447,517	E905V	probably damaging	Het

Other mutations in Zfyve9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00162:Zfyve9	APN	4	108642107	missense	possibly damaging	0.85
IGL01161:Zfyve9	APN	4	108681064	missense	probably damaging	1.00
IGL01404:Zfyve9	APN	4	108682151	missense	probably damaging	1.00
IGL01451:Zfyve9	APN	4	108682260	missense	probably damaging	0.98
IGL01655:Zfyve9	APN	4	108642092	missense	probably damaging	1.00
IGL02567:Zfyve9	APN	4	108674523	missense	probably damaging	1.00
IGL02593:Zfyve9	APN	4	108682223	missense	possibly damaging	0.73
IGL03169:Zfyve9	APN	4	108695825	missense	probably damaging	1.00
IGL03206:Zfyve9	APN	4	108689209	missense	possibly damaging	0.88
IGL03288:Zfyve9	APN	4	108723799	splice site	probably benign
R0008:Zfyve9	UTSW	4	108718705	missense	possibly damaging	0.92
R0008:Zfyve9	UTSW	4	108718705	missense	possibly damaging	0.92
R0104:Zfyve9	UTSW	4	108718163	missense	probably damaging	1.00
R0104:Zfyve9	UTSW	4	108718163	missense	probably damaging	1.00
R0362:Zfyve9	UTSW	4	108680969	missense	probably damaging	0.96
R0502:Zfyve9	UTSW	4	108719764	nonsense	probably null
R0503:Zfyve9	UTSW	4	108719764	nonsense	probably null
R0557:Zfyve9	UTSW	4	108674511	missense	probably damaging	0.98
R0835:Zfyve9	UTSW	4	108718669	missense	probably damaging	0.99
R1215:Zfyve9	UTSW	4	108650229	missense	probably benign	0.32
R1245:Zfyve9	UTSW	4	108693311	intron	probably benign
R1527:Zfyve9	UTSW	4	108695767	critical splice donor site	probably null
R1638:Zfyve9	UTSW	4	108684907	critical splice donor site	probably null
R1653:Zfyve9	UTSW	4	108660577	nonsense	probably null
R1728:Zfyve9	UTSW	4	108718501	missense	possibly damaging	0.80
R1729:Zfyve9	UTSW	4	108718501	missense	possibly damaging	0.80
R1861:Zfyve9	UTSW	4	108682295	splice site	probably benign
R1983:Zfyve9	UTSW	4	108689189	missense	possibly damaging	0.94
R2050:Zfyve9	UTSW	4	108718603	missense	probably benign	0.05
R2050:Zfyve9	UTSW	4	108719303	missense	possibly damaging	0.94
R2246:Zfyve9	UTSW	4	108689264	missense	possibly damaging	0.70
R2338:Zfyve9	UTSW	4	108660614	missense	probably damaging	1.00
R2697:Zfyve9	UTSW	4	108695819	missense	probably damaging	0.99
R3522:Zfyve9	UTSW	4	108719743	missense	probably benign	0.45
R4030:Zfyve9	UTSW	4	108719701	missense	possibly damaging	0.61
R4247:Zfyve9	UTSW	4	108719192	missense	probably benign	0.28
R4273:Zfyve9	UTSW	4	108680976	missense	probably damaging	1.00
R4720:Zfyve9	UTSW	4	108644368	missense	possibly damaging	0.94
R4835:Zfyve9	UTSW	4	108717998	missense	possibly damaging	0.70
R4871:Zfyve9	UTSW	4	108680986	missense	probably damaging	1.00
R4881:Zfyve9	UTSW	4	108727491	splice site	probably null
R4974:Zfyve9	UTSW	4	108680900	critical splice donor site	probably null
R5024:Zfyve9	UTSW	4	108691669	missense	probably benign	0.18
R5481:Zfyve9	UTSW	4	108644349	missense	probably damaging	1.00
R5660:Zfyve9	UTSW	4	108719168	missense	probably benign
R5965:Zfyve9	UTSW	4	108691681	missense	possibly damaging	0.53
R5996:Zfyve9	UTSW	4	108719360	missense	probably benign	0.07
R6315:Zfyve9	UTSW	4	108674488	missense	probably damaging	1.00
R6772:Zfyve9	UTSW	4	108639269	missense	probably damaging	1.00
R6865:Zfyve9	UTSW	4	108644361	missense	possibly damaging	0.71
R7112:Zfyve9	UTSW	4	108650322	missense	probably benign	0.00
R7258:Zfyve9	UTSW	4	108656954	missense	possibly damaging	0.94
R7266:Zfyve9	UTSW	4	108718547	missense	possibly damaging	0.62
R7287:Zfyve9	UTSW	4	108718256	missense	probably benign	0.00
R7356:Zfyve9	UTSW	4	108719015	missense	probably benign	0.01
R7389:Zfyve9	UTSW	4	108693318	critical splice donor site	probably null
R7729:Zfyve9	UTSW	4	108691776	missense	probably benign	0.01
R7780:Zfyve9	UTSW	4	108719101	missense	possibly damaging	0.81
R7801:Zfyve9	UTSW	4	108684995	missense	possibly damaging	0.50
R8069:Zfyve9	UTSW	4	108685018	missense	probably benign	0.32
R8201:Zfyve9	UTSW	4	108650277	missense	possibly damaging	0.83
R8221:Zfyve9	UTSW	4	108719680	missense	possibly damaging	0.77
R8682:Zfyve9	UTSW	4	108719342	missense	probably benign	0.30
R8948:Zfyve9	UTSW	4	108642091	missense	possibly damaging	0.84
R8960:Zfyve9	UTSW	4	108644361	missense	possibly damaging	0.71
R9123:Zfyve9	UTSW	4	108718563	missense	probably benign	0.30
R9135:Zfyve9	UTSW	4	108682189	nonsense	probably null
R9439:Zfyve9	UTSW	4	108644341	missense	probably benign	0.33
R9449:Zfyve9	UTSW	4	108719238	missense	probably damaging	1.00
R9560:Zfyve9	UTSW	4	108718137	missense	possibly damaging	0.82
R9657:Zfyve9	UTSW	4	108718532	missense	probably damaging	1.00
R9691:Zfyve9	UTSW	4	108719108	missense	probably benign
R9717:Zfyve9	UTSW	4	108682137	missense	probably benign	0.11
Z1176:Zfyve9	UTSW	4	108642207	missense	possibly damaging	0.85

Predicted Primers

PCR Primer
(F):5'- CCTCCTGTGAGAAGGAAGGTAATG -3'
(R):5'- TGCACAGGCTGTAATCCCAG -3'

Sequencing Primer
(F):5'- AAGGTAATGCCCTGGGATGCC -3'
(R):5'- CAGCACTTGGAATTGGGAAGGTG -3'

Posted On

2022-09-12