Incidental Mutation 'R9603:Zfyve9'
ID 723779
Institutional Source Beutler Lab
Gene Symbol Zfyve9
Ensembl Gene ENSMUSG00000034557
Gene Name zinc finger, FYVE domain containing 9
Synonyms Madhip
MMRRC Submission
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.431) question?
Stock # R9603 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 108494663-108637995 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 108499288 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 1284 (D1284E)
Ref Sequence ENSEMBL: ENSMUSP00000102269 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042185] [ENSMUST00000106657] [ENSMUST00000106658]
AlphaFold A2A8R0
Predicted Effect probably benign
Transcript: ENSMUST00000042185
AA Change: D652E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000039852
Gene: ENSMUSG00000034557
AA Change: D652E

DomainStartEndE-ValueType
Blast:FYVE 7 40 4e-7 BLAST
Pfam:SARA 52 92 1e-25 PFAM
Pfam:DUF3480 328 681 1.4e-189 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000106657
AA Change: D1343E

PolyPhen 2 Score 0.710 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000102268
Gene: ENSMUSG00000034557
AA Change: D1343E

DomainStartEndE-ValueType
low complexity region 230 243 N/A INTRINSIC
low complexity region 471 487 N/A INTRINSIC
low complexity region 578 587 N/A INTRINSIC
Blast:FYVE 590 618 7e-6 BLAST
FYVE 663 731 2.38e-26 SMART
Pfam:SARA 745 783 1.3e-22 PFAM
Pfam:DUF3480 1020 1372 1e-178 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000106658
AA Change: D1284E

PolyPhen 2 Score 0.837 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000102269
Gene: ENSMUSG00000034557
AA Change: D1284E

DomainStartEndE-ValueType
low complexity region 230 243 N/A INTRINSIC
low complexity region 471 487 N/A INTRINSIC
low complexity region 578 587 N/A INTRINSIC
Blast:FYVE 590 618 8e-6 BLAST
FYVE 663 731 2.38e-26 SMART
Pfam:DUF3480 960 1313 5.5e-189 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a double zinc finger motif-containing protein that participates in the transforming growth factor-beta (TGFB) signalling pathway. The encoded protein interacts directly with SMAD2 and SMAD3, and recruits SMAD2 to the TGFB receptor. There are multiple pseudogenes for this gene on chromosomes 2, 15, and X. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2013]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl6 A T 11: 54,225,911 (GRCm39) N317I probably damaging Het
Adam18 T A 8: 25,118,147 (GRCm39) S590C possibly damaging Het
Btrc G A 19: 45,459,526 (GRCm39) E103K probably benign Het
Cars1 A G 7: 143,112,929 (GRCm39) M766T possibly damaging Het
Cavin4 T C 4: 48,671,999 (GRCm39) V148A probably benign Het
Cdcp3 T C 7: 130,830,643 (GRCm39) V359A probably damaging Het
Cdkn2d T C 9: 21,202,139 (GRCm39) D36G possibly damaging Het
Cubn A T 2: 13,292,510 (GRCm39) D3224E probably damaging Het
Ebf1 A G 11: 44,509,006 (GRCm39) M1V probably null Het
Eif1ad7 T G 12: 88,238,727 (GRCm39) N11T unknown Het
Fcgbp A G 7: 27,802,563 (GRCm39) D1497G probably damaging Het
Foxs1 A C 2: 152,774,281 (GRCm39) C257W probably damaging Het
Fstl5 C T 3: 76,496,260 (GRCm39) P341L probably damaging Het
Fzd10 G A 5: 128,678,771 (GRCm39) G164S probably benign Het
Hrh3 C A 2: 179,742,444 (GRCm39) E395* probably null Het
Hsf4 G A 8: 105,999,435 (GRCm39) V318M probably damaging Het
Il21 T C 3: 37,281,949 (GRCm39) E65G possibly damaging Het
Kank1 A G 19: 25,408,289 (GRCm39) D1256G possibly damaging Het
Klhl22 A G 16: 17,594,915 (GRCm39) N348S possibly damaging Het
Krr1 T C 10: 111,812,672 (GRCm39) I94T probably damaging Het
Lpin2 A G 17: 71,550,410 (GRCm39) D724G probably damaging Het
Mn1 C A 5: 111,566,393 (GRCm39) P121Q probably damaging Het
Mphosph9 A T 5: 124,463,015 (GRCm39) L10* probably null Het
Mtus1 A T 8: 41,536,795 (GRCm39) V307E probably benign Het
Muc20 A G 16: 32,615,155 (GRCm39) L74P probably damaging Het
Nnat A G 2: 157,403,701 (GRCm39) *113W probably null Het
Or13a25 G T 7: 140,247,794 (GRCm39) C191F probably damaging Het
Or2f1b C T 6: 42,739,672 (GRCm39) Q229* probably null Het
Or4f14 A G 2: 111,743,128 (GRCm39) V49A possibly damaging Het
Or6b6 A T 7: 106,571,103 (GRCm39) Y149* probably null Het
Pkm T A 9: 59,577,831 (GRCm39) V216E probably damaging Het
Pla2g12a G A 3: 129,674,900 (GRCm39) V19I unknown Het
Pramel27 T C 4: 143,578,267 (GRCm39) S176P Het
Rai14 G A 15: 10,595,116 (GRCm39) Q136* probably null Het
Rnf150 T A 8: 83,717,208 (GRCm39) N238K possibly damaging Het
Rrp1 A G 10: 78,240,757 (GRCm39) probably null Het
Scaf8 T A 17: 3,246,070 (GRCm39) L720M possibly damaging Het
Slamf1 G T 1: 171,625,771 (GRCm39) V316L probably damaging Het
Slc14a1 C A 18: 78,152,807 (GRCm39) A367S probably damaging Het
Slc25a20 T C 9: 108,549,675 (GRCm39) F86L probably benign Het
Slc4a5 T G 6: 83,217,714 (GRCm39) S131A probably benign Het
Slitrk3 A G 3: 72,958,649 (GRCm39) I41T probably benign Het
Sntg1 A T 1: 8,748,198 (GRCm39) L94Q probably damaging Het
St18 T C 1: 6,915,811 (GRCm39) C819R probably damaging Het
St6galnac3 T A 3: 153,117,177 (GRCm39) D182V probably benign Het
Tubgcp2 T A 7: 139,584,789 (GRCm39) T549S probably benign Het
Vim A T 2: 13,579,148 (GRCm39) probably benign Het
Vmn2r118 C A 17: 55,899,837 (GRCm39) R689I probably damaging Het
Zbtb41 A T 1: 139,375,255 (GRCm39) E905V probably damaging Het
Other mutations in Zfyve9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Zfyve9 APN 4 108,499,304 (GRCm39) missense possibly damaging 0.85
IGL01161:Zfyve9 APN 4 108,538,261 (GRCm39) missense probably damaging 1.00
IGL01404:Zfyve9 APN 4 108,539,348 (GRCm39) missense probably damaging 1.00
IGL01451:Zfyve9 APN 4 108,539,457 (GRCm39) missense probably damaging 0.98
IGL01655:Zfyve9 APN 4 108,499,289 (GRCm39) missense probably damaging 1.00
IGL02567:Zfyve9 APN 4 108,531,720 (GRCm39) missense probably damaging 1.00
IGL02593:Zfyve9 APN 4 108,539,420 (GRCm39) missense possibly damaging 0.73
IGL03169:Zfyve9 APN 4 108,553,022 (GRCm39) missense probably damaging 1.00
IGL03206:Zfyve9 APN 4 108,546,406 (GRCm39) missense possibly damaging 0.88
IGL03288:Zfyve9 APN 4 108,580,996 (GRCm39) splice site probably benign
R0008:Zfyve9 UTSW 4 108,575,902 (GRCm39) missense possibly damaging 0.92
R0008:Zfyve9 UTSW 4 108,575,902 (GRCm39) missense possibly damaging 0.92
R0104:Zfyve9 UTSW 4 108,575,360 (GRCm39) missense probably damaging 1.00
R0104:Zfyve9 UTSW 4 108,575,360 (GRCm39) missense probably damaging 1.00
R0362:Zfyve9 UTSW 4 108,538,166 (GRCm39) missense probably damaging 0.96
R0502:Zfyve9 UTSW 4 108,576,961 (GRCm39) nonsense probably null
R0503:Zfyve9 UTSW 4 108,576,961 (GRCm39) nonsense probably null
R0557:Zfyve9 UTSW 4 108,531,708 (GRCm39) missense probably damaging 0.98
R0835:Zfyve9 UTSW 4 108,575,866 (GRCm39) missense probably damaging 0.99
R1215:Zfyve9 UTSW 4 108,507,426 (GRCm39) missense probably benign 0.32
R1245:Zfyve9 UTSW 4 108,550,508 (GRCm39) intron probably benign
R1527:Zfyve9 UTSW 4 108,552,964 (GRCm39) critical splice donor site probably null
R1638:Zfyve9 UTSW 4 108,542,104 (GRCm39) critical splice donor site probably null
R1653:Zfyve9 UTSW 4 108,517,774 (GRCm39) nonsense probably null
R1728:Zfyve9 UTSW 4 108,575,698 (GRCm39) missense possibly damaging 0.80
R1729:Zfyve9 UTSW 4 108,575,698 (GRCm39) missense possibly damaging 0.80
R1861:Zfyve9 UTSW 4 108,539,492 (GRCm39) splice site probably benign
R1983:Zfyve9 UTSW 4 108,546,386 (GRCm39) missense possibly damaging 0.94
R2050:Zfyve9 UTSW 4 108,576,500 (GRCm39) missense possibly damaging 0.94
R2050:Zfyve9 UTSW 4 108,575,800 (GRCm39) missense probably benign 0.05
R2246:Zfyve9 UTSW 4 108,546,461 (GRCm39) missense possibly damaging 0.70
R2338:Zfyve9 UTSW 4 108,517,811 (GRCm39) missense probably damaging 1.00
R2697:Zfyve9 UTSW 4 108,553,016 (GRCm39) missense probably damaging 0.99
R3522:Zfyve9 UTSW 4 108,576,940 (GRCm39) missense probably benign 0.45
R4030:Zfyve9 UTSW 4 108,576,898 (GRCm39) missense possibly damaging 0.61
R4247:Zfyve9 UTSW 4 108,576,389 (GRCm39) missense probably benign 0.28
R4273:Zfyve9 UTSW 4 108,538,173 (GRCm39) missense probably damaging 1.00
R4720:Zfyve9 UTSW 4 108,501,565 (GRCm39) missense possibly damaging 0.94
R4835:Zfyve9 UTSW 4 108,575,195 (GRCm39) missense possibly damaging 0.70
R4871:Zfyve9 UTSW 4 108,538,183 (GRCm39) missense probably damaging 1.00
R4881:Zfyve9 UTSW 4 108,584,688 (GRCm39) splice site probably null
R4974:Zfyve9 UTSW 4 108,538,097 (GRCm39) critical splice donor site probably null
R5024:Zfyve9 UTSW 4 108,548,866 (GRCm39) missense probably benign 0.18
R5481:Zfyve9 UTSW 4 108,501,546 (GRCm39) missense probably damaging 1.00
R5660:Zfyve9 UTSW 4 108,576,365 (GRCm39) missense probably benign
R5965:Zfyve9 UTSW 4 108,548,878 (GRCm39) missense possibly damaging 0.53
R5996:Zfyve9 UTSW 4 108,576,557 (GRCm39) missense probably benign 0.07
R6315:Zfyve9 UTSW 4 108,531,685 (GRCm39) missense probably damaging 1.00
R6772:Zfyve9 UTSW 4 108,496,466 (GRCm39) missense probably damaging 1.00
R6865:Zfyve9 UTSW 4 108,501,558 (GRCm39) missense possibly damaging 0.71
R7112:Zfyve9 UTSW 4 108,507,519 (GRCm39) missense probably benign 0.00
R7258:Zfyve9 UTSW 4 108,514,151 (GRCm39) missense possibly damaging 0.94
R7266:Zfyve9 UTSW 4 108,575,744 (GRCm39) missense possibly damaging 0.62
R7287:Zfyve9 UTSW 4 108,575,453 (GRCm39) missense probably benign 0.00
R7356:Zfyve9 UTSW 4 108,576,212 (GRCm39) missense probably benign 0.01
R7389:Zfyve9 UTSW 4 108,550,515 (GRCm39) critical splice donor site probably null
R7729:Zfyve9 UTSW 4 108,548,973 (GRCm39) missense probably benign 0.01
R7780:Zfyve9 UTSW 4 108,576,298 (GRCm39) missense possibly damaging 0.81
R7801:Zfyve9 UTSW 4 108,542,192 (GRCm39) missense possibly damaging 0.50
R8069:Zfyve9 UTSW 4 108,542,215 (GRCm39) missense probably benign 0.32
R8201:Zfyve9 UTSW 4 108,507,474 (GRCm39) missense possibly damaging 0.83
R8221:Zfyve9 UTSW 4 108,576,877 (GRCm39) missense possibly damaging 0.77
R8682:Zfyve9 UTSW 4 108,576,539 (GRCm39) missense probably benign 0.30
R8948:Zfyve9 UTSW 4 108,499,288 (GRCm39) missense possibly damaging 0.84
R8960:Zfyve9 UTSW 4 108,501,558 (GRCm39) missense possibly damaging 0.71
R9123:Zfyve9 UTSW 4 108,575,760 (GRCm39) missense probably benign 0.30
R9135:Zfyve9 UTSW 4 108,539,386 (GRCm39) nonsense probably null
R9439:Zfyve9 UTSW 4 108,501,538 (GRCm39) missense probably benign 0.33
R9449:Zfyve9 UTSW 4 108,576,435 (GRCm39) missense probably damaging 1.00
R9560:Zfyve9 UTSW 4 108,575,334 (GRCm39) missense possibly damaging 0.82
R9657:Zfyve9 UTSW 4 108,575,729 (GRCm39) missense probably damaging 1.00
R9691:Zfyve9 UTSW 4 108,576,305 (GRCm39) missense probably benign
R9717:Zfyve9 UTSW 4 108,539,334 (GRCm39) missense probably benign 0.11
Z1176:Zfyve9 UTSW 4 108,499,404 (GRCm39) missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- CCTCCTGTGAGAAGGAAGGTAATG -3'
(R):5'- TGCACAGGCTGTAATCCCAG -3'

Sequencing Primer
(F):5'- AAGGTAATGCCCTGGGATGCC -3'
(R):5'- CAGCACTTGGAATTGGGAAGGTG -3'
Posted On 2022-09-12