Incidental Mutation 'R9603:Mn1'
ID 723781
Institutional Source Beutler Lab
Gene Symbol Mn1
Ensembl Gene ENSMUSG00000070576
Gene Name meningioma 1
Synonyms
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9603 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 111565228-111604899 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 111566393 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Glutamine at position 121 (P121Q)
Ref Sequence ENSEMBL: ENSMUSP00000092034 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094463]
AlphaFold D3YWE6
Predicted Effect probably damaging
Transcript: ENSMUST00000094463
AA Change: P121Q

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000092034
Gene: ENSMUSG00000070576
AA Change: P121Q

DomainStartEndE-ValueType
low complexity region 92 124 N/A INTRINSIC
low complexity region 128 144 N/A INTRINSIC
low complexity region 201 217 N/A INTRINSIC
low complexity region 291 303 N/A INTRINSIC
low complexity region 333 354 N/A INTRINSIC
coiled coil region 507 548 N/A INTRINSIC
low complexity region 551 565 N/A INTRINSIC
low complexity region 569 584 N/A INTRINSIC
low complexity region 643 657 N/A INTRINSIC
low complexity region 685 704 N/A INTRINSIC
low complexity region 708 725 N/A INTRINSIC
low complexity region 727 738 N/A INTRINSIC
low complexity region 745 771 N/A INTRINSIC
low complexity region 780 791 N/A INTRINSIC
low complexity region 862 892 N/A INTRINSIC
low complexity region 913 933 N/A INTRINSIC
low complexity region 957 972 N/A INTRINSIC
low complexity region 1098 1110 N/A INTRINSIC
low complexity region 1134 1145 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Meningioma 1 (MN1) contains two sets of CAG repeats. It is disrupted by a balanced translocation (4;22) in a meningioma, and its inactivation may contribute to meningioma 32 pathogenesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice die shortly after birth due to cleft palate. Development of several bones in the skull was abnormal with completely absent alisphenoid, squamosal, and vomer bones, hypoplastic basisphenoid, pterygoid, and presphenoid bones, and thinfrontal, parietal, and interparietal bones. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl6 A T 11: 54,225,911 (GRCm39) N317I probably damaging Het
Adam18 T A 8: 25,118,147 (GRCm39) S590C possibly damaging Het
Btrc G A 19: 45,459,526 (GRCm39) E103K probably benign Het
Cars1 A G 7: 143,112,929 (GRCm39) M766T possibly damaging Het
Cavin4 T C 4: 48,671,999 (GRCm39) V148A probably benign Het
Cdcp3 T C 7: 130,830,643 (GRCm39) V359A probably damaging Het
Cdkn2d T C 9: 21,202,139 (GRCm39) D36G possibly damaging Het
Cubn A T 2: 13,292,510 (GRCm39) D3224E probably damaging Het
Ebf1 A G 11: 44,509,006 (GRCm39) M1V probably null Het
Eif1ad7 T G 12: 88,238,727 (GRCm39) N11T unknown Het
Fcgbp A G 7: 27,802,563 (GRCm39) D1497G probably damaging Het
Foxs1 A C 2: 152,774,281 (GRCm39) C257W probably damaging Het
Fstl5 C T 3: 76,496,260 (GRCm39) P341L probably damaging Het
Fzd10 G A 5: 128,678,771 (GRCm39) G164S probably benign Het
Hrh3 C A 2: 179,742,444 (GRCm39) E395* probably null Het
Hsf4 G A 8: 105,999,435 (GRCm39) V318M probably damaging Het
Il21 T C 3: 37,281,949 (GRCm39) E65G possibly damaging Het
Kank1 A G 19: 25,408,289 (GRCm39) D1256G possibly damaging Het
Klhl22 A G 16: 17,594,915 (GRCm39) N348S possibly damaging Het
Krr1 T C 10: 111,812,672 (GRCm39) I94T probably damaging Het
Lpin2 A G 17: 71,550,410 (GRCm39) D724G probably damaging Het
Mphosph9 A T 5: 124,463,015 (GRCm39) L10* probably null Het
Mtus1 A T 8: 41,536,795 (GRCm39) V307E probably benign Het
Muc20 A G 16: 32,615,155 (GRCm39) L74P probably damaging Het
Nnat A G 2: 157,403,701 (GRCm39) *113W probably null Het
Or13a25 G T 7: 140,247,794 (GRCm39) C191F probably damaging Het
Or2f1b C T 6: 42,739,672 (GRCm39) Q229* probably null Het
Or4f14 A G 2: 111,743,128 (GRCm39) V49A possibly damaging Het
Or6b6 A T 7: 106,571,103 (GRCm39) Y149* probably null Het
Pkm T A 9: 59,577,831 (GRCm39) V216E probably damaging Het
Pla2g12a G A 3: 129,674,900 (GRCm39) V19I unknown Het
Pramel27 T C 4: 143,578,267 (GRCm39) S176P Het
Rai14 G A 15: 10,595,116 (GRCm39) Q136* probably null Het
Rnf150 T A 8: 83,717,208 (GRCm39) N238K possibly damaging Het
Rrp1 A G 10: 78,240,757 (GRCm39) probably null Het
Scaf8 T A 17: 3,246,070 (GRCm39) L720M possibly damaging Het
Slamf1 G T 1: 171,625,771 (GRCm39) V316L probably damaging Het
Slc14a1 C A 18: 78,152,807 (GRCm39) A367S probably damaging Het
Slc25a20 T C 9: 108,549,675 (GRCm39) F86L probably benign Het
Slc4a5 T G 6: 83,217,714 (GRCm39) S131A probably benign Het
Slitrk3 A G 3: 72,958,649 (GRCm39) I41T probably benign Het
Sntg1 A T 1: 8,748,198 (GRCm39) L94Q probably damaging Het
St18 T C 1: 6,915,811 (GRCm39) C819R probably damaging Het
St6galnac3 T A 3: 153,117,177 (GRCm39) D182V probably benign Het
Tubgcp2 T A 7: 139,584,789 (GRCm39) T549S probably benign Het
Vim A T 2: 13,579,148 (GRCm39) probably benign Het
Vmn2r118 C A 17: 55,899,837 (GRCm39) R689I probably damaging Het
Zbtb41 A T 1: 139,375,255 (GRCm39) E905V probably damaging Het
Zfyve9 A T 4: 108,499,288 (GRCm39) D1284E possibly damaging Het
Other mutations in Mn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01019:Mn1 APN 5 111,569,413 (GRCm39) missense possibly damaging 0.85
IGL01139:Mn1 APN 5 111,569,315 (GRCm39) missense probably damaging 0.96
IGL01546:Mn1 APN 5 111,569,114 (GRCm39) missense probably damaging 1.00
IGL02252:Mn1 APN 5 111,569,107 (GRCm39) missense probably damaging 0.96
IGL02821:Mn1 APN 5 111,569,717 (GRCm39) missense probably damaging 0.99
IGL03203:Mn1 APN 5 111,569,269 (GRCm39) missense probably benign
Uebermus UTSW 5 111,569,752 (GRCm39) splice site probably null
FR4342:Mn1 UTSW 5 111,567,572 (GRCm39) small insertion probably benign
FR4449:Mn1 UTSW 5 111,567,576 (GRCm39) small insertion probably benign
FR4548:Mn1 UTSW 5 111,567,564 (GRCm39) small insertion probably benign
FR4976:Mn1 UTSW 5 111,567,568 (GRCm39) small insertion probably benign
R0639:Mn1 UTSW 5 111,567,182 (GRCm39) missense probably damaging 1.00
R0676:Mn1 UTSW 5 111,568,900 (GRCm39) missense possibly damaging 0.52
R1537:Mn1 UTSW 5 111,602,646 (GRCm39) missense probably damaging 0.96
R1638:Mn1 UTSW 5 111,569,435 (GRCm39) missense probably damaging 1.00
R1739:Mn1 UTSW 5 111,567,880 (GRCm39) missense possibly damaging 0.92
R1922:Mn1 UTSW 5 111,566,612 (GRCm39) missense probably damaging 0.99
R2008:Mn1 UTSW 5 111,566,723 (GRCm39) missense probably damaging 1.00
R2104:Mn1 UTSW 5 111,602,617 (GRCm39) missense possibly damaging 0.72
R2519:Mn1 UTSW 5 111,566,418 (GRCm39) missense possibly damaging 0.85
R3980:Mn1 UTSW 5 111,569,636 (GRCm39) missense possibly damaging 0.85
R4008:Mn1 UTSW 5 111,568,035 (GRCm39) missense probably benign
R4564:Mn1 UTSW 5 111,568,533 (GRCm39) missense possibly damaging 0.93
R4647:Mn1 UTSW 5 111,567,949 (GRCm39) missense probably benign
R4779:Mn1 UTSW 5 111,567,526 (GRCm39) missense probably damaging 0.99
R4819:Mn1 UTSW 5 111,567,803 (GRCm39) missense possibly damaging 0.93
R4962:Mn1 UTSW 5 111,602,652 (GRCm39) missense possibly damaging 0.85
R5373:Mn1 UTSW 5 111,569,752 (GRCm39) splice site probably null
R5374:Mn1 UTSW 5 111,569,752 (GRCm39) splice site probably null
R5521:Mn1 UTSW 5 111,569,635 (GRCm39) missense possibly damaging 0.72
R5633:Mn1 UTSW 5 111,568,192 (GRCm39) missense possibly damaging 0.52
R5744:Mn1 UTSW 5 111,568,402 (GRCm39) missense possibly damaging 0.93
R6050:Mn1 UTSW 5 111,567,263 (GRCm39) missense probably damaging 1.00
R6552:Mn1 UTSW 5 111,568,753 (GRCm39) missense possibly damaging 0.93
R7206:Mn1 UTSW 5 111,568,378 (GRCm39) missense possibly damaging 0.85
R7244:Mn1 UTSW 5 111,566,699 (GRCm39) missense possibly damaging 0.78
R8207:Mn1 UTSW 5 111,569,651 (GRCm39) missense probably damaging 0.99
R8222:Mn1 UTSW 5 111,566,546 (GRCm39) missense probably damaging 1.00
R8353:Mn1 UTSW 5 111,568,505 (GRCm39) missense possibly damaging 0.85
R8677:Mn1 UTSW 5 111,566,885 (GRCm39) nonsense probably null
R8990:Mn1 UTSW 5 111,566,381 (GRCm39) missense possibly damaging 0.85
R9602:Mn1 UTSW 5 111,565,449 (GRCm39) start gained probably benign
RF025:Mn1 UTSW 5 111,567,571 (GRCm39) nonsense probably null
RF027:Mn1 UTSW 5 111,567,571 (GRCm39) small insertion probably benign
RF028:Mn1 UTSW 5 111,567,577 (GRCm39) small insertion probably benign
RF032:Mn1 UTSW 5 111,567,577 (GRCm39) small insertion probably benign
RF040:Mn1 UTSW 5 111,567,571 (GRCm39) small insertion probably benign
Z1088:Mn1 UTSW 5 111,566,146 (GRCm39) missense possibly damaging 0.85
Z1176:Mn1 UTSW 5 111,602,572 (GRCm39) missense possibly damaging 0.93
Z1176:Mn1 UTSW 5 111,568,245 (GRCm39) missense probably benign 0.08
Z1177:Mn1 UTSW 5 111,567,934 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCATGAACGCCCACTTTAAG -3'
(R):5'- TGCCCGAACTATGGAAGTCC -3'

Sequencing Primer
(F):5'- CCCGATCTTGGGCTTGAACATG -3'
(R):5'- CCGAACTATGGAAGTCCGGGAG -3'
Posted On 2022-09-12