Incidental Mutation 'R9603:Fzd10'
ID 723783
Institutional Source Beutler Lab
Gene Symbol Fzd10
Ensembl Gene ENSMUSG00000081683
Gene Name frizzled class receptor 10
Synonyms Fz-10
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9603 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 128600844-128604093 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 128601707 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Serine at position 164 (G164S)
Ref Sequence ENSEMBL: ENSMUSP00000114114 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117102]
AlphaFold Q8BKG4
Predicted Effect probably benign
Transcript: ENSMUST00000117102
AA Change: G164S

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000114114
Gene: ENSMUSG00000081683
AA Change: G164S

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
FRI 34 153 7.83e-68 SMART
Frizzled 218 542 2.62e-207 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the frizzled gene family. Members of this family encode 7-transmembrane domain proteins that are receptors for the Wingless type MMTV integration site family of signaling proteins. Most frizzled receptors are coupled to the beta-catenin canonical signaling pathway. Using array analysis, expression of this intronless gene is significantly up-regulated in two cases of primary colon cancer. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene does not appear to result in a phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik T C 7: 131,228,914 V359A probably damaging Het
Acsl6 A T 11: 54,335,085 N317I probably damaging Het
Adam18 T A 8: 24,628,131 S590C possibly damaging Het
Btrc G A 19: 45,471,087 E103K probably benign Het
Cars A G 7: 143,559,192 M766T possibly damaging Het
Cavin4 T C 4: 48,671,999 V148A probably benign Het
Cdkn2d T C 9: 21,290,843 D36G possibly damaging Het
Cubn A T 2: 13,287,699 D3224E probably damaging Het
Ebf1 A G 11: 44,618,179 M1V probably null Het
Fcgbp A G 7: 28,103,138 D1497G probably damaging Het
Foxs1 A C 2: 152,932,361 C257W probably damaging Het
Fstl5 C T 3: 76,588,953 P341L probably damaging Het
Gm13103 T C 4: 143,851,697 S176P Het
Gm5662 T G 12: 88,271,957 N11T unknown Het
Hrh3 C A 2: 180,100,651 E395* probably null Het
Hsf4 G A 8: 105,272,803 V318M probably damaging Het
Il21 T C 3: 37,227,800 E65G possibly damaging Het
Kank1 A G 19: 25,430,925 D1256G possibly damaging Het
Klhl22 A G 16: 17,777,051 N348S possibly damaging Het
Krr1 T C 10: 111,976,767 I94T probably damaging Het
Lpin2 A G 17: 71,243,415 D724G probably damaging Het
Mn1 C A 5: 111,418,527 P121Q probably damaging Het
Mphosph9 A T 5: 124,324,952 L10* probably null Het
Mtus1 A T 8: 41,083,758 V307E probably benign Het
Muc20 A G 16: 32,794,785 L74P probably damaging Het
Nnat A G 2: 157,561,781 *113W probably null Het
Olfr1306 A G 2: 111,912,783 V49A possibly damaging Het
Olfr38 C T 6: 42,762,738 Q229* probably null Het
Olfr539 G T 7: 140,667,881 C191F probably damaging Het
Olfr711 A T 7: 106,971,896 Y149* probably null Het
Pkm T A 9: 59,670,548 V216E probably damaging Het
Pla2g12a G A 3: 129,881,251 V19I unknown Het
Rai14 G A 15: 10,595,030 Q136* probably null Het
Rnf150 T A 8: 82,990,579 N238K possibly damaging Het
Rrp1 A G 10: 78,404,923 probably null Het
Scaf8 T A 17: 3,195,795 L720M possibly damaging Het
Slamf1 G T 1: 171,798,203 V316L probably damaging Het
Slc14a1 C A 18: 78,109,592 A367S probably damaging Het
Slc25a20 T C 9: 108,672,476 F86L probably benign Het
Slc4a5 T G 6: 83,240,732 S131A probably benign Het
Slitrk3 A G 3: 73,051,316 I41T probably benign Het
Sntg1 A T 1: 8,677,974 L94Q probably damaging Het
St18 T C 1: 6,845,587 C819R probably damaging Het
St6galnac3 T A 3: 153,411,540 D182V probably benign Het
Tubgcp2 T A 7: 140,004,876 T549S probably benign Het
Vim A T 2: 13,574,337 probably benign Het
Vmn2r118 C A 17: 55,592,837 R689I probably damaging Het
Zbtb41 A T 1: 139,447,517 E905V probably damaging Het
Zfyve9 A T 4: 108,642,091 D1284E possibly damaging Het
Other mutations in Fzd10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Fzd10 APN 5 128601528 missense probably damaging 1.00
IGL02354:Fzd10 APN 5 128601868 missense possibly damaging 0.89
IGL02361:Fzd10 APN 5 128601868 missense possibly damaging 0.89
IGL03088:Fzd10 APN 5 128602605 missense possibly damaging 0.81
R0530:Fzd10 UTSW 5 128602013 missense probably damaging 1.00
R0645:Fzd10 UTSW 5 128602598 missense possibly damaging 0.94
R1515:Fzd10 UTSW 5 128602559 missense probably damaging 1.00
R3930:Fzd10 UTSW 5 128602412 missense probably damaging 1.00
R4467:Fzd10 UTSW 5 128601276 missense probably benign 0.01
R4976:Fzd10 UTSW 5 128602114 nonsense probably null
R5156:Fzd10 UTSW 5 128601302 missense possibly damaging 0.68
R5202:Fzd10 UTSW 5 128602116 missense possibly damaging 0.78
R5874:Fzd10 UTSW 5 128601300 missense probably benign 0.41
R6238:Fzd10 UTSW 5 128602931 missense probably damaging 0.99
R6921:Fzd10 UTSW 5 128601582 missense probably damaging 0.99
R7684:Fzd10 UTSW 5 128601416 missense possibly damaging 0.73
R8093:Fzd10 UTSW 5 128602239 missense probably benign 0.14
R9011:Fzd10 UTSW 5 128602305 missense probably damaging 1.00
R9013:Fzd10 UTSW 5 128602305 missense probably damaging 1.00
R9014:Fzd10 UTSW 5 128602305 missense probably damaging 1.00
R9332:Fzd10 UTSW 5 128601252 missense possibly damaging 0.92
Z1088:Fzd10 UTSW 5 128601246 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CCATCCAACTGCACGAGTTC -3'
(R):5'- TCGCGGCTCCAATACACATC -3'

Sequencing Primer
(F):5'- TGGAGTACGGCTGCCACAG -3'
(R):5'- ACATCCACCCCCGGAGTG -3'
Posted On 2022-09-12