Mutagenetix > Incidental Mutation

Incidental Mutation 'R9603:Slc4a5'

723785

Institutional Source

Beutler Lab

Gene Symbol

Slc4a5

Ensembl Gene

ENSMUSG00000068323

Gene Name

solute carrier family 4, sodium bicarbonate cotransporter, member 5

Synonyms

C330016K18Rik

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.177) question?

Stock #

R9603 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

83219828-83304945 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 83240732 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Alanine at position 131 (S131A)

Ref Sequence

ENSEMBL: ENSMUSP00000109533 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039212] [ENSMUST00000113899] [ENSMUST00000113900]

AlphaFold

E9Q3M5

Predicted Effect

probably benign
Transcript: ENSMUST00000039212
AA Change: S16A

PolyPhen 2 Score 0.100 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000041007
Gene: ENSMUSG00000068323
AA Change: S16A

Domain	Start	End	E-Value	Type
Pfam:Band_3_cyto	25	292	5.2e-102	PFAM
low complexity region	321	350	N/A	INTRINSIC
Pfam:HCO3_cotransp	364	884	1.1e-242	PFAM
transmembrane domain	891	913	N/A	INTRINSIC
low complexity region	936	951	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000113899
AA Change: S16A

PolyPhen 2 Score 0.220 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000109532
Gene: ENSMUSG00000068323
AA Change: S16A

Domain	Start	End	E-Value	Type
Pfam:Band_3_cyto	25	292	2.9e-102	PFAM
low complexity region	321	350	N/A	INTRINSIC
Pfam:HCO3_cotransp	364	884	5.3e-243	PFAM
transmembrane domain	891	913	N/A	INTRINSIC
low complexity region	936	951	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000113900
AA Change: S131A

PolyPhen 2 Score 0.341 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000109533
Gene: ENSMUSG00000068323
AA Change: S131A

Domain	Start	End	E-Value	Type
Pfam:Band_3_cyto	140	407	3.4e-106	PFAM
low complexity region	436	465	N/A	INTRINSIC
Pfam:HCO3_cotransp	480	999	1.6e-224	PFAM
transmembrane domain	1006	1028	N/A	INTRINSIC
low complexity region	1051	1066	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sodium bicarbonate cotransporter (NBC) family, part of the bicarbonate transporter superfamily. Sodium bicarbonate cotransporters are involved in intracellular pH regulation and electroneural or electrogenic sodium bicarbonate transport. This protein is thought to be an integral membrane protein. Multiple transcript variants encoding different isoforms have been found for this gene, but the biological validity of some variants has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit arterial hypertension and renal metabolic acidosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5430419D17Rik	T	C	7: 131,228,914	V359A	probably damaging	Het
Acsl6	A	T	11: 54,335,085	N317I	probably damaging	Het
Adam18	T	A	8: 24,628,131	S590C	possibly damaging	Het
Btrc	G	A	19: 45,471,087	E103K	probably benign	Het
Cars	A	G	7: 143,559,192	M766T	possibly damaging	Het
Cavin4	T	C	4: 48,671,999	V148A	probably benign	Het
Cdkn2d	T	C	9: 21,290,843	D36G	possibly damaging	Het
Cubn	A	T	2: 13,287,699	D3224E	probably damaging	Het
Ebf1	A	G	11: 44,618,179	M1V	probably null	Het
Fcgbp	A	G	7: 28,103,138	D1497G	probably damaging	Het
Foxs1	A	C	2: 152,932,361	C257W	probably damaging	Het
Fstl5	C	T	3: 76,588,953	P341L	probably damaging	Het
Fzd10	G	A	5: 128,601,707	G164S	probably benign	Het
Gm13103	T	C	4: 143,851,697	S176P		Het
Gm5662	T	G	12: 88,271,957	N11T	unknown	Het
Hrh3	C	A	2: 180,100,651	E395*	probably null	Het
Hsf4	G	A	8: 105,272,803	V318M	probably damaging	Het
Il21	T	C	3: 37,227,800	E65G	possibly damaging	Het
Kank1	A	G	19: 25,430,925	D1256G	possibly damaging	Het
Klhl22	A	G	16: 17,777,051	N348S	possibly damaging	Het
Krr1	T	C	10: 111,976,767	I94T	probably damaging	Het
Lpin2	A	G	17: 71,243,415	D724G	probably damaging	Het
Mn1	C	A	5: 111,418,527	P121Q	probably damaging	Het
Mphosph9	A	T	5: 124,324,952	L10*	probably null	Het
Mtus1	A	T	8: 41,083,758	V307E	probably benign	Het
Muc20	A	G	16: 32,794,785	L74P	probably damaging	Het
Nnat	A	G	2: 157,561,781	*113W	probably null	Het
Olfr1306	A	G	2: 111,912,783	V49A	possibly damaging	Het
Olfr38	C	T	6: 42,762,738	Q229*	probably null	Het
Olfr539	G	T	7: 140,667,881	C191F	probably damaging	Het
Olfr711	A	T	7: 106,971,896	Y149*	probably null	Het
Pkm	T	A	9: 59,670,548	V216E	probably damaging	Het
Pla2g12a	G	A	3: 129,881,251	V19I	unknown	Het
Rai14	G	A	15: 10,595,030	Q136*	probably null	Het
Rnf150	T	A	8: 82,990,579	N238K	possibly damaging	Het
Rrp1	A	G	10: 78,404,923		probably null	Het
Scaf8	T	A	17: 3,195,795	L720M	possibly damaging	Het
Slamf1	G	T	1: 171,798,203	V316L	probably damaging	Het
Slc14a1	C	A	18: 78,109,592	A367S	probably damaging	Het
Slc25a20	T	C	9: 108,672,476	F86L	probably benign	Het
Slitrk3	A	G	3: 73,051,316	I41T	probably benign	Het
Sntg1	A	T	1: 8,677,974	L94Q	probably damaging	Het
St18	T	C	1: 6,845,587	C819R	probably damaging	Het
St6galnac3	T	A	3: 153,411,540	D182V	probably benign	Het
Tubgcp2	T	A	7: 140,004,876	T549S	probably benign	Het
Vim	A	T	2: 13,574,337		probably benign	Het
Vmn2r118	C	A	17: 55,592,837	R689I	probably damaging	Het
Zbtb41	A	T	1: 139,447,517	E905V	probably damaging	Het
Zfyve9	A	T	4: 108,642,091	D1284E	possibly damaging	Het

Other mutations in Slc4a5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00235:Slc4a5	APN	6	83285899	missense	probably damaging	1.00
IGL00473:Slc4a5	APN	6	83296597	missense	probably damaging	1.00
IGL00861:Slc4a5	APN	6	83299471	missense	probably benign
IGL01025:Slc4a5	APN	6	83262533	missense	probably damaging	0.98
IGL01532:Slc4a5	APN	6	83273040	splice site	probably null
IGL01991:Slc4a5	APN	6	83263543	missense	possibly damaging	0.94
IGL02271:Slc4a5	APN	6	83271103	splice site	probably benign
IGL02565:Slc4a5	APN	6	83299505	missense	probably benign	0.00
IGL02669:Slc4a5	APN	6	83263543	missense	possibly damaging	0.79
IGL02994:Slc4a5	APN	6	83272124	missense	probably damaging	1.00
IGL03259:Slc4a5	APN	6	83270997	missense	probably damaging	1.00
IGL03264:Slc4a5	APN	6	83261525	missense	probably damaging	1.00
R0032:Slc4a5	UTSW	6	83273157	missense	probably damaging	1.00
R0091:Slc4a5	UTSW	6	83277555	missense	probably benign	0.00
R0281:Slc4a5	UTSW	6	83267567	splice site	probably benign
R0366:Slc4a5	UTSW	6	83295872	missense	probably benign	0.02
R0668:Slc4a5	UTSW	6	83271072	missense	probably damaging	1.00
R1222:Slc4a5	UTSW	6	83280132	missense	probably damaging	1.00
R1550:Slc4a5	UTSW	6	83271057	missense	probably damaging	1.00
R1585:Slc4a5	UTSW	6	83265687	missense	probably damaging	1.00
R1731:Slc4a5	UTSW	6	83296635	missense	probably damaging	1.00
R1987:Slc4a5	UTSW	6	83273232	missense	possibly damaging	0.95
R2103:Slc4a5	UTSW	6	83224681	missense	probably benign	0.00
R2103:Slc4a5	UTSW	6	83297378	missense	probably benign	0.00
R2104:Slc4a5	UTSW	6	83297378	missense	probably benign	0.00
R2176:Slc4a5	UTSW	6	83262560	missense	probably damaging	0.98
R2920:Slc4a5	UTSW	6	83264387	missense	probably damaging	1.00
R2964:Slc4a5	UTSW	6	83296669	missense	probably damaging	1.00
R2965:Slc4a5	UTSW	6	83296669	missense	probably damaging	1.00
R2966:Slc4a5	UTSW	6	83296669	missense	probably damaging	1.00
R3755:Slc4a5	UTSW	6	83288303	missense	probably benign	0.26
R3756:Slc4a5	UTSW	6	83288303	missense	probably benign	0.26
R4293:Slc4a5	UTSW	6	83260529	missense	probably damaging	1.00
R4789:Slc4a5	UTSW	6	83270969	missense	probably benign	0.05
R4823:Slc4a5	UTSW	6	83272133	missense	probably damaging	1.00
R4854:Slc4a5	UTSW	6	83271017	missense	probably benign	0.00
R5461:Slc4a5	UTSW	6	83285854	missense	probably benign	0.29
R5707:Slc4a5	UTSW	6	83261415	missense	probably benign	0.11
R5747:Slc4a5	UTSW	6	83271029	missense	probably damaging	1.00
R5978:Slc4a5	UTSW	6	83277536	missense	probably benign	0.01
R6126:Slc4a5	UTSW	6	83226265	missense	probably benign	0.05
R6330:Slc4a5	UTSW	6	83226374	missense	probably benign
R6564:Slc4a5	UTSW	6	83280060	missense	possibly damaging	0.71
R6786:Slc4a5	UTSW	6	83296747	critical splice donor site	probably null
R7443:Slc4a5	UTSW	6	83264315	missense	probably benign	0.45
R7672:Slc4a5	UTSW	6	83260535	missense	probably damaging	1.00
R7690:Slc4a5	UTSW	6	83285872	missense	probably damaging	1.00
R7837:Slc4a5	UTSW	6	83261557	missense	probably benign	0.01
R8169:Slc4a5	UTSW	6	83303391	missense	probably benign	0.12
R8288:Slc4a5	UTSW	6	83226255	missense	probably benign	0.01
R8397:Slc4a5	UTSW	6	83289326	critical splice donor site	probably null
R8849:Slc4a5	UTSW	6	83273198	missense	probably damaging	1.00
R9033:Slc4a5	UTSW	6	83260475	nonsense	probably null
R9133:Slc4a5	UTSW	6	83226235	missense	possibly damaging	0.85
R9201:Slc4a5	UTSW	6	83285830	missense	probably benign	0.02
R9269:Slc4a5	UTSW	6	83289241	missense	possibly damaging	0.88
R9781:Slc4a5	UTSW	6	83262484	missense	probably benign	0.00
Z1177:Slc4a5	UTSW	6	83280033	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AATGGAGAAATACCCCTCCCTTG -3'
(R):5'- GAAGTGTCGTTTCTTTGACAACAAC -3'

Sequencing Primer
(F):5'- GCTCTGTTCCTGTGGGCC -3'
(R):5'- ACAACAATCATTTATGTTTGCTCCC -3'

Posted On

2022-09-12