Incidental Mutation 'R9603:Slc4a5'
ID 723785
Institutional Source Beutler Lab
Gene Symbol Slc4a5
Ensembl Gene ENSMUSG00000068323
Gene Name solute carrier family 4, sodium bicarbonate cotransporter, member 5
Synonyms C330016K18Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.177) question?
Stock # R9603 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 83219828-83304945 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 83240732 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Alanine at position 131 (S131A)
Ref Sequence ENSEMBL: ENSMUSP00000109533 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039212] [ENSMUST00000113899] [ENSMUST00000113900]
AlphaFold E9Q3M5
Predicted Effect probably benign
Transcript: ENSMUST00000039212
AA Change: S16A

PolyPhen 2 Score 0.100 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000041007
Gene: ENSMUSG00000068323
AA Change: S16A

DomainStartEndE-ValueType
Pfam:Band_3_cyto 25 292 5.2e-102 PFAM
low complexity region 321 350 N/A INTRINSIC
Pfam:HCO3_cotransp 364 884 1.1e-242 PFAM
transmembrane domain 891 913 N/A INTRINSIC
low complexity region 936 951 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113899
AA Change: S16A

PolyPhen 2 Score 0.220 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000109532
Gene: ENSMUSG00000068323
AA Change: S16A

DomainStartEndE-ValueType
Pfam:Band_3_cyto 25 292 2.9e-102 PFAM
low complexity region 321 350 N/A INTRINSIC
Pfam:HCO3_cotransp 364 884 5.3e-243 PFAM
transmembrane domain 891 913 N/A INTRINSIC
low complexity region 936 951 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113900
AA Change: S131A

PolyPhen 2 Score 0.341 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000109533
Gene: ENSMUSG00000068323
AA Change: S131A

DomainStartEndE-ValueType
Pfam:Band_3_cyto 140 407 3.4e-106 PFAM
low complexity region 436 465 N/A INTRINSIC
Pfam:HCO3_cotransp 480 999 1.6e-224 PFAM
transmembrane domain 1006 1028 N/A INTRINSIC
low complexity region 1051 1066 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sodium bicarbonate cotransporter (NBC) family, part of the bicarbonate transporter superfamily. Sodium bicarbonate cotransporters are involved in intracellular pH regulation and electroneural or electrogenic sodium bicarbonate transport. This protein is thought to be an integral membrane protein. Multiple transcript variants encoding different isoforms have been found for this gene, but the biological validity of some variants has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit arterial hypertension and renal metabolic acidosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik T C 7: 131,228,914 V359A probably damaging Het
Acsl6 A T 11: 54,335,085 N317I probably damaging Het
Adam18 T A 8: 24,628,131 S590C possibly damaging Het
Btrc G A 19: 45,471,087 E103K probably benign Het
Cars A G 7: 143,559,192 M766T possibly damaging Het
Cavin4 T C 4: 48,671,999 V148A probably benign Het
Cdkn2d T C 9: 21,290,843 D36G possibly damaging Het
Cubn A T 2: 13,287,699 D3224E probably damaging Het
Ebf1 A G 11: 44,618,179 M1V probably null Het
Fcgbp A G 7: 28,103,138 D1497G probably damaging Het
Foxs1 A C 2: 152,932,361 C257W probably damaging Het
Fstl5 C T 3: 76,588,953 P341L probably damaging Het
Fzd10 G A 5: 128,601,707 G164S probably benign Het
Gm13103 T C 4: 143,851,697 S176P Het
Gm5662 T G 12: 88,271,957 N11T unknown Het
Hrh3 C A 2: 180,100,651 E395* probably null Het
Hsf4 G A 8: 105,272,803 V318M probably damaging Het
Il21 T C 3: 37,227,800 E65G possibly damaging Het
Kank1 A G 19: 25,430,925 D1256G possibly damaging Het
Klhl22 A G 16: 17,777,051 N348S possibly damaging Het
Krr1 T C 10: 111,976,767 I94T probably damaging Het
Lpin2 A G 17: 71,243,415 D724G probably damaging Het
Mn1 C A 5: 111,418,527 P121Q probably damaging Het
Mphosph9 A T 5: 124,324,952 L10* probably null Het
Mtus1 A T 8: 41,083,758 V307E probably benign Het
Muc20 A G 16: 32,794,785 L74P probably damaging Het
Nnat A G 2: 157,561,781 *113W probably null Het
Olfr1306 A G 2: 111,912,783 V49A possibly damaging Het
Olfr38 C T 6: 42,762,738 Q229* probably null Het
Olfr539 G T 7: 140,667,881 C191F probably damaging Het
Olfr711 A T 7: 106,971,896 Y149* probably null Het
Pkm T A 9: 59,670,548 V216E probably damaging Het
Pla2g12a G A 3: 129,881,251 V19I unknown Het
Rai14 G A 15: 10,595,030 Q136* probably null Het
Rnf150 T A 8: 82,990,579 N238K possibly damaging Het
Rrp1 A G 10: 78,404,923 probably null Het
Scaf8 T A 17: 3,195,795 L720M possibly damaging Het
Slamf1 G T 1: 171,798,203 V316L probably damaging Het
Slc14a1 C A 18: 78,109,592 A367S probably damaging Het
Slc25a20 T C 9: 108,672,476 F86L probably benign Het
Slitrk3 A G 3: 73,051,316 I41T probably benign Het
Sntg1 A T 1: 8,677,974 L94Q probably damaging Het
St18 T C 1: 6,845,587 C819R probably damaging Het
St6galnac3 T A 3: 153,411,540 D182V probably benign Het
Tubgcp2 T A 7: 140,004,876 T549S probably benign Het
Vim A T 2: 13,574,337 probably benign Het
Vmn2r118 C A 17: 55,592,837 R689I probably damaging Het
Zbtb41 A T 1: 139,447,517 E905V probably damaging Het
Zfyve9 A T 4: 108,642,091 D1284E possibly damaging Het
Other mutations in Slc4a5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Slc4a5 APN 6 83285899 missense probably damaging 1.00
IGL00473:Slc4a5 APN 6 83296597 missense probably damaging 1.00
IGL00861:Slc4a5 APN 6 83299471 missense probably benign
IGL01025:Slc4a5 APN 6 83262533 missense probably damaging 0.98
IGL01532:Slc4a5 APN 6 83273040 splice site probably null
IGL01991:Slc4a5 APN 6 83263543 missense possibly damaging 0.94
IGL02271:Slc4a5 APN 6 83271103 splice site probably benign
IGL02565:Slc4a5 APN 6 83299505 missense probably benign 0.00
IGL02669:Slc4a5 APN 6 83263543 missense possibly damaging 0.79
IGL02994:Slc4a5 APN 6 83272124 missense probably damaging 1.00
IGL03259:Slc4a5 APN 6 83270997 missense probably damaging 1.00
IGL03264:Slc4a5 APN 6 83261525 missense probably damaging 1.00
R0032:Slc4a5 UTSW 6 83273157 missense probably damaging 1.00
R0091:Slc4a5 UTSW 6 83277555 missense probably benign 0.00
R0281:Slc4a5 UTSW 6 83267567 splice site probably benign
R0366:Slc4a5 UTSW 6 83295872 missense probably benign 0.02
R0668:Slc4a5 UTSW 6 83271072 missense probably damaging 1.00
R1222:Slc4a5 UTSW 6 83280132 missense probably damaging 1.00
R1550:Slc4a5 UTSW 6 83271057 missense probably damaging 1.00
R1585:Slc4a5 UTSW 6 83265687 missense probably damaging 1.00
R1731:Slc4a5 UTSW 6 83296635 missense probably damaging 1.00
R1987:Slc4a5 UTSW 6 83273232 missense possibly damaging 0.95
R2103:Slc4a5 UTSW 6 83224681 missense probably benign 0.00
R2103:Slc4a5 UTSW 6 83297378 missense probably benign 0.00
R2104:Slc4a5 UTSW 6 83297378 missense probably benign 0.00
R2176:Slc4a5 UTSW 6 83262560 missense probably damaging 0.98
R2920:Slc4a5 UTSW 6 83264387 missense probably damaging 1.00
R2964:Slc4a5 UTSW 6 83296669 missense probably damaging 1.00
R2965:Slc4a5 UTSW 6 83296669 missense probably damaging 1.00
R2966:Slc4a5 UTSW 6 83296669 missense probably damaging 1.00
R3755:Slc4a5 UTSW 6 83288303 missense probably benign 0.26
R3756:Slc4a5 UTSW 6 83288303 missense probably benign 0.26
R4293:Slc4a5 UTSW 6 83260529 missense probably damaging 1.00
R4789:Slc4a5 UTSW 6 83270969 missense probably benign 0.05
R4823:Slc4a5 UTSW 6 83272133 missense probably damaging 1.00
R4854:Slc4a5 UTSW 6 83271017 missense probably benign 0.00
R5461:Slc4a5 UTSW 6 83285854 missense probably benign 0.29
R5707:Slc4a5 UTSW 6 83261415 missense probably benign 0.11
R5747:Slc4a5 UTSW 6 83271029 missense probably damaging 1.00
R5978:Slc4a5 UTSW 6 83277536 missense probably benign 0.01
R6126:Slc4a5 UTSW 6 83226265 missense probably benign 0.05
R6330:Slc4a5 UTSW 6 83226374 missense probably benign
R6564:Slc4a5 UTSW 6 83280060 missense possibly damaging 0.71
R6786:Slc4a5 UTSW 6 83296747 critical splice donor site probably null
R7443:Slc4a5 UTSW 6 83264315 missense probably benign 0.45
R7672:Slc4a5 UTSW 6 83260535 missense probably damaging 1.00
R7690:Slc4a5 UTSW 6 83285872 missense probably damaging 1.00
R7837:Slc4a5 UTSW 6 83261557 missense probably benign 0.01
R8169:Slc4a5 UTSW 6 83303391 missense probably benign 0.12
R8288:Slc4a5 UTSW 6 83226255 missense probably benign 0.01
R8397:Slc4a5 UTSW 6 83289326 critical splice donor site probably null
R8849:Slc4a5 UTSW 6 83273198 missense probably damaging 1.00
R9033:Slc4a5 UTSW 6 83260475 nonsense probably null
R9133:Slc4a5 UTSW 6 83226235 missense possibly damaging 0.85
R9201:Slc4a5 UTSW 6 83285830 missense probably benign 0.02
R9269:Slc4a5 UTSW 6 83289241 missense possibly damaging 0.88
R9781:Slc4a5 UTSW 6 83262484 missense probably benign 0.00
Z1177:Slc4a5 UTSW 6 83280033 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATGGAGAAATACCCCTCCCTTG -3'
(R):5'- GAAGTGTCGTTTCTTTGACAACAAC -3'

Sequencing Primer
(F):5'- GCTCTGTTCCTGTGGGCC -3'
(R):5'- ACAACAATCATTTATGTTTGCTCCC -3'
Posted On 2022-09-12