Incidental Mutation 'R9603:Olfr711'
ID 723787
Institutional Source Beutler Lab
Gene Symbol Olfr711
Ensembl Gene ENSMUSG00000045013
Gene Name olfactory receptor 711
Synonyms GA_x6K02T2PBJ9-9352783-9351839, MOR103-4
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock # R9603 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 106969694-106975453 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 106971896 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 149 (Y149*)
Ref Sequence ENSEMBL: ENSMUSP00000055724 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051715] [ENSMUST00000207200] [ENSMUST00000216335]
AlphaFold Q9EPG2
Predicted Effect probably null
Transcript: ENSMUST00000051715
AA Change: Y149*
SMART Domains Protein: ENSMUSP00000055724
Gene: ENSMUSG00000045013
AA Change: Y149*

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1.5e-58 PFAM
Pfam:7tm_1 41 290 1.2e-19 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000207200
AA Change: Y149*
Predicted Effect probably null
Transcript: ENSMUST00000216335
AA Change: Y149*
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik T C 7: 131,228,914 V359A probably damaging Het
Acsl6 A T 11: 54,335,085 N317I probably damaging Het
Adam18 T A 8: 24,628,131 S590C possibly damaging Het
Btrc G A 19: 45,471,087 E103K probably benign Het
Cars A G 7: 143,559,192 M766T possibly damaging Het
Cavin4 T C 4: 48,671,999 V148A probably benign Het
Cdkn2d T C 9: 21,290,843 D36G possibly damaging Het
Cubn A T 2: 13,287,699 D3224E probably damaging Het
Ebf1 A G 11: 44,618,179 M1V probably null Het
Fcgbp A G 7: 28,103,138 D1497G probably damaging Het
Foxs1 A C 2: 152,932,361 C257W probably damaging Het
Fstl5 C T 3: 76,588,953 P341L probably damaging Het
Fzd10 G A 5: 128,601,707 G164S probably benign Het
Gm13103 T C 4: 143,851,697 S176P Het
Gm5662 T G 12: 88,271,957 N11T unknown Het
Hrh3 C A 2: 180,100,651 E395* probably null Het
Hsf4 G A 8: 105,272,803 V318M probably damaging Het
Il21 T C 3: 37,227,800 E65G possibly damaging Het
Kank1 A G 19: 25,430,925 D1256G possibly damaging Het
Klhl22 A G 16: 17,777,051 N348S possibly damaging Het
Krr1 T C 10: 111,976,767 I94T probably damaging Het
Lpin2 A G 17: 71,243,415 D724G probably damaging Het
Mn1 C A 5: 111,418,527 P121Q probably damaging Het
Mphosph9 A T 5: 124,324,952 L10* probably null Het
Mtus1 A T 8: 41,083,758 V307E probably benign Het
Muc20 A G 16: 32,794,785 L74P probably damaging Het
Nnat A G 2: 157,561,781 *113W probably null Het
Olfr1306 A G 2: 111,912,783 V49A possibly damaging Het
Olfr38 C T 6: 42,762,738 Q229* probably null Het
Olfr539 G T 7: 140,667,881 C191F probably damaging Het
Pkm T A 9: 59,670,548 V216E probably damaging Het
Pla2g12a G A 3: 129,881,251 V19I unknown Het
Rai14 G A 15: 10,595,030 Q136* probably null Het
Rnf150 T A 8: 82,990,579 N238K possibly damaging Het
Rrp1 A G 10: 78,404,923 probably null Het
Scaf8 T A 17: 3,195,795 L720M possibly damaging Het
Slamf1 G T 1: 171,798,203 V316L probably damaging Het
Slc14a1 C A 18: 78,109,592 A367S probably damaging Het
Slc25a20 T C 9: 108,672,476 F86L probably benign Het
Slc4a5 T G 6: 83,240,732 S131A probably benign Het
Slitrk3 A G 3: 73,051,316 I41T probably benign Het
Sntg1 A T 1: 8,677,974 L94Q probably damaging Het
St18 T C 1: 6,845,587 C819R probably damaging Het
St6galnac3 T A 3: 153,411,540 D182V probably benign Het
Tubgcp2 T A 7: 140,004,876 T549S probably benign Het
Vim A T 2: 13,574,337 probably benign Het
Vmn2r118 C A 17: 55,592,837 R689I probably damaging Het
Zbtb41 A T 1: 139,447,517 E905V probably damaging Het
Zfyve9 A T 4: 108,642,091 D1284E possibly damaging Het
Other mutations in Olfr711
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02600:Olfr711 APN 7 106971549 missense possibly damaging 0.51
R0087:Olfr711 UTSW 7 106972116 missense probably benign 0.01
R0580:Olfr711 UTSW 7 106972240 missense probably damaging 1.00
R1375:Olfr711 UTSW 7 106972098 missense probably damaging 1.00
R1538:Olfr711 UTSW 7 106971983 nonsense probably null
R1875:Olfr711 UTSW 7 106972182 missense possibly damaging 0.86
R2156:Olfr711 UTSW 7 106971568 missense probably damaging 1.00
R4290:Olfr711 UTSW 7 106971711 missense probably damaging 0.97
R4332:Olfr711 UTSW 7 106972147 missense probably benign 0.00
R4400:Olfr711 UTSW 7 106972002 missense probably damaging 1.00
R4688:Olfr711 UTSW 7 106971861 missense probably benign 0.02
R4868:Olfr711 UTSW 7 106971767 missense probably benign
R4970:Olfr711 UTSW 7 106971571 missense probably benign 0.35
R5006:Olfr711 UTSW 7 106971601 missense probably damaging 1.00
R5082:Olfr711 UTSW 7 106971664 missense probably benign 0.00
R5121:Olfr711 UTSW 7 106972231 missense probably benign
R6465:Olfr711 UTSW 7 106972212 missense possibly damaging 0.63
R6541:Olfr711 UTSW 7 106972203 missense probably benign 0.20
R7419:Olfr711 UTSW 7 106972146 missense probably benign 0.01
R8048:Olfr711 UTSW 7 106972464 start gained probably benign
R9310:Olfr711 UTSW 7 106971471 missense probably damaging 1.00
R9470:Olfr711 UTSW 7 106972254 missense probably benign 0.26
Z1177:Olfr711 UTSW 7 106971915 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGGTAGACACTATGTAGACGTAGG -3'
(R):5'- ACGGCACATCTCCTTCACAG -3'

Sequencing Primer
(F):5'- CACTATGTAGACGTAGGAGAGGAC -3'
(R):5'- TTCACAGGCTGTATGACTCAG -3'
Posted On 2022-09-12