Incidental Mutation 'R9603:Or13a25'
ID 723790
Institutional Source Beutler Lab
Gene Symbol Or13a25
Ensembl Gene ENSMUSG00000059136
Gene Name olfactory receptor family 13 subfamily A member 25
Synonyms GA_x6K02T2PBJ9-42813436-42814368, Olfr539, MOR253-4
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.055) question?
Stock # R9603 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 140247202-140248161 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 140247794 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Phenylalanine at position 191 (C191F)
Ref Sequence ENSEMBL: ENSMUSP00000151522 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078967] [ENSMUST00000218865]
AlphaFold Q8VGL9
Predicted Effect probably damaging
Transcript: ENSMUST00000078967
AA Change: C198F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000077990
Gene: ENSMUSG00000059136
AA Change: C198F

DomainStartEndE-ValueType
Pfam:7tm_4 40 316 6.5e-50 PFAM
Pfam:7tm_1 50 299 4.9e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000218865
AA Change: C191F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl6 A T 11: 54,225,911 (GRCm39) N317I probably damaging Het
Adam18 T A 8: 25,118,147 (GRCm39) S590C possibly damaging Het
Btrc G A 19: 45,459,526 (GRCm39) E103K probably benign Het
Cars1 A G 7: 143,112,929 (GRCm39) M766T possibly damaging Het
Cavin4 T C 4: 48,671,999 (GRCm39) V148A probably benign Het
Cdcp3 T C 7: 130,830,643 (GRCm39) V359A probably damaging Het
Cdkn2d T C 9: 21,202,139 (GRCm39) D36G possibly damaging Het
Cubn A T 2: 13,292,510 (GRCm39) D3224E probably damaging Het
Ebf1 A G 11: 44,509,006 (GRCm39) M1V probably null Het
Eif1ad7 T G 12: 88,238,727 (GRCm39) N11T unknown Het
Fcgbp A G 7: 27,802,563 (GRCm39) D1497G probably damaging Het
Foxs1 A C 2: 152,774,281 (GRCm39) C257W probably damaging Het
Fstl5 C T 3: 76,496,260 (GRCm39) P341L probably damaging Het
Fzd10 G A 5: 128,678,771 (GRCm39) G164S probably benign Het
Hrh3 C A 2: 179,742,444 (GRCm39) E395* probably null Het
Hsf4 G A 8: 105,999,435 (GRCm39) V318M probably damaging Het
Il21 T C 3: 37,281,949 (GRCm39) E65G possibly damaging Het
Kank1 A G 19: 25,408,289 (GRCm39) D1256G possibly damaging Het
Klhl22 A G 16: 17,594,915 (GRCm39) N348S possibly damaging Het
Krr1 T C 10: 111,812,672 (GRCm39) I94T probably damaging Het
Lpin2 A G 17: 71,550,410 (GRCm39) D724G probably damaging Het
Mn1 C A 5: 111,566,393 (GRCm39) P121Q probably damaging Het
Mphosph9 A T 5: 124,463,015 (GRCm39) L10* probably null Het
Mtus1 A T 8: 41,536,795 (GRCm39) V307E probably benign Het
Muc20 A G 16: 32,615,155 (GRCm39) L74P probably damaging Het
Nnat A G 2: 157,403,701 (GRCm39) *113W probably null Het
Or2f1b C T 6: 42,739,672 (GRCm39) Q229* probably null Het
Or4f14 A G 2: 111,743,128 (GRCm39) V49A possibly damaging Het
Or6b6 A T 7: 106,571,103 (GRCm39) Y149* probably null Het
Pkm T A 9: 59,577,831 (GRCm39) V216E probably damaging Het
Pla2g12a G A 3: 129,674,900 (GRCm39) V19I unknown Het
Pramel27 T C 4: 143,578,267 (GRCm39) S176P Het
Rai14 G A 15: 10,595,116 (GRCm39) Q136* probably null Het
Rnf150 T A 8: 83,717,208 (GRCm39) N238K possibly damaging Het
Rrp1 A G 10: 78,240,757 (GRCm39) probably null Het
Scaf8 T A 17: 3,246,070 (GRCm39) L720M possibly damaging Het
Slamf1 G T 1: 171,625,771 (GRCm39) V316L probably damaging Het
Slc14a1 C A 18: 78,152,807 (GRCm39) A367S probably damaging Het
Slc25a20 T C 9: 108,549,675 (GRCm39) F86L probably benign Het
Slc4a5 T G 6: 83,217,714 (GRCm39) S131A probably benign Het
Slitrk3 A G 3: 72,958,649 (GRCm39) I41T probably benign Het
Sntg1 A T 1: 8,748,198 (GRCm39) L94Q probably damaging Het
St18 T C 1: 6,915,811 (GRCm39) C819R probably damaging Het
St6galnac3 T A 3: 153,117,177 (GRCm39) D182V probably benign Het
Tubgcp2 T A 7: 139,584,789 (GRCm39) T549S probably benign Het
Vim A T 2: 13,579,148 (GRCm39) probably benign Het
Vmn2r118 C A 17: 55,899,837 (GRCm39) R689I probably damaging Het
Zbtb41 A T 1: 139,375,255 (GRCm39) E905V probably damaging Het
Zfyve9 A T 4: 108,499,288 (GRCm39) D1284E possibly damaging Het
Other mutations in Or13a25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Or13a25 APN 7 140,247,854 (GRCm39) missense probably benign 0.01
IGL01610:Or13a25 APN 7 140,247,584 (GRCm39) missense probably damaging 1.00
IGL02959:Or13a25 APN 7 140,247,463 (GRCm39) missense probably damaging 1.00
IGL03406:Or13a25 APN 7 140,247,424 (GRCm39) missense probably damaging 1.00
R0671:Or13a25 UTSW 7 140,247,590 (GRCm39) missense probably damaging 1.00
R1771:Or13a25 UTSW 7 140,248,048 (GRCm39) missense probably benign
R1934:Or13a25 UTSW 7 140,247,951 (GRCm39) nonsense probably null
R1985:Or13a25 UTSW 7 140,247,734 (GRCm39) missense probably damaging 1.00
R2962:Or13a25 UTSW 7 140,247,862 (GRCm39) missense probably benign
R4239:Or13a25 UTSW 7 140,247,496 (GRCm39) missense probably benign 0.07
R4240:Or13a25 UTSW 7 140,247,496 (GRCm39) missense probably benign 0.07
R4360:Or13a25 UTSW 7 140,247,730 (GRCm39) missense probably damaging 0.98
R4841:Or13a25 UTSW 7 140,247,502 (GRCm39) missense probably damaging 1.00
R4842:Or13a25 UTSW 7 140,247,502 (GRCm39) missense probably damaging 1.00
R4851:Or13a25 UTSW 7 140,247,226 (GRCm39) missense probably benign
R5325:Or13a25 UTSW 7 140,247,705 (GRCm39) missense probably benign 0.33
R5766:Or13a25 UTSW 7 140,247,266 (GRCm39) missense probably benign 0.02
R6363:Or13a25 UTSW 7 140,247,995 (GRCm39) missense possibly damaging 0.93
R6836:Or13a25 UTSW 7 140,248,093 (GRCm39) missense possibly damaging 0.86
R7777:Or13a25 UTSW 7 140,247,854 (GRCm39) missense probably benign 0.01
R7920:Or13a25 UTSW 7 140,247,814 (GRCm39) missense possibly damaging 0.92
R8134:Or13a25 UTSW 7 140,247,680 (GRCm39) missense possibly damaging 0.90
R8712:Or13a25 UTSW 7 140,248,052 (GRCm39) missense possibly damaging 0.89
R9095:Or13a25 UTSW 7 140,247,813 (GRCm39) missense probably damaging 1.00
R9158:Or13a25 UTSW 7 140,247,547 (GRCm39) missense possibly damaging 0.76
Predicted Primers PCR Primer
(F):5'- TGACCGCTATGTGGCTATCTG -3'
(R):5'- TGAGTAGTACACAGAGACCACAATG -3'

Sequencing Primer
(F):5'- TCCCCTACACTACAGCTCTAGGATG -3'
(R):5'- TACACAGAGACCACAATGAGGTG -3'
Posted On 2022-09-12