Incidental Mutation 'R9603:Olfr539'
ID 723790
Institutional Source Beutler Lab
Gene Symbol Olfr539
Ensembl Gene ENSMUSG00000059136
Gene Name olfactory receptor 539
Synonyms MOR253-4, GA_x6K02T2PBJ9-42813436-42814368
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.052) question?
Stock # R9603 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 140659930-140678580 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 140667881 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Phenylalanine at position 191 (C191F)
Ref Sequence ENSEMBL: ENSMUSP00000151522 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078967] [ENSMUST00000218865]
AlphaFold Q8VGL9
Predicted Effect probably damaging
Transcript: ENSMUST00000078967
AA Change: C198F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000077990
Gene: ENSMUSG00000059136
AA Change: C198F

DomainStartEndE-ValueType
Pfam:7tm_4 40 316 6.5e-50 PFAM
Pfam:7tm_1 50 299 4.9e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000218865
AA Change: C191F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik T C 7: 131,228,914 V359A probably damaging Het
Acsl6 A T 11: 54,335,085 N317I probably damaging Het
Adam18 T A 8: 24,628,131 S590C possibly damaging Het
Btrc G A 19: 45,471,087 E103K probably benign Het
Cars A G 7: 143,559,192 M766T possibly damaging Het
Cavin4 T C 4: 48,671,999 V148A probably benign Het
Cdkn2d T C 9: 21,290,843 D36G possibly damaging Het
Cubn A T 2: 13,287,699 D3224E probably damaging Het
Ebf1 A G 11: 44,618,179 M1V probably null Het
Fcgbp A G 7: 28,103,138 D1497G probably damaging Het
Foxs1 A C 2: 152,932,361 C257W probably damaging Het
Fstl5 C T 3: 76,588,953 P341L probably damaging Het
Fzd10 G A 5: 128,601,707 G164S probably benign Het
Gm13103 T C 4: 143,851,697 S176P Het
Gm5662 T G 12: 88,271,957 N11T unknown Het
Hrh3 C A 2: 180,100,651 E395* probably null Het
Hsf4 G A 8: 105,272,803 V318M probably damaging Het
Il21 T C 3: 37,227,800 E65G possibly damaging Het
Kank1 A G 19: 25,430,925 D1256G possibly damaging Het
Klhl22 A G 16: 17,777,051 N348S possibly damaging Het
Krr1 T C 10: 111,976,767 I94T probably damaging Het
Lpin2 A G 17: 71,243,415 D724G probably damaging Het
Mn1 C A 5: 111,418,527 P121Q probably damaging Het
Mphosph9 A T 5: 124,324,952 L10* probably null Het
Mtus1 A T 8: 41,083,758 V307E probably benign Het
Muc20 A G 16: 32,794,785 L74P probably damaging Het
Nnat A G 2: 157,561,781 *113W probably null Het
Olfr1306 A G 2: 111,912,783 V49A possibly damaging Het
Olfr38 C T 6: 42,762,738 Q229* probably null Het
Olfr711 A T 7: 106,971,896 Y149* probably null Het
Pkm T A 9: 59,670,548 V216E probably damaging Het
Pla2g12a G A 3: 129,881,251 V19I unknown Het
Rai14 G A 15: 10,595,030 Q136* probably null Het
Rnf150 T A 8: 82,990,579 N238K possibly damaging Het
Rrp1 A G 10: 78,404,923 probably null Het
Scaf8 T A 17: 3,195,795 L720M possibly damaging Het
Slamf1 G T 1: 171,798,203 V316L probably damaging Het
Slc14a1 C A 18: 78,109,592 A367S probably damaging Het
Slc25a20 T C 9: 108,672,476 F86L probably benign Het
Slc4a5 T G 6: 83,240,732 S131A probably benign Het
Slitrk3 A G 3: 73,051,316 I41T probably benign Het
Sntg1 A T 1: 8,677,974 L94Q probably damaging Het
St18 T C 1: 6,845,587 C819R probably damaging Het
St6galnac3 T A 3: 153,411,540 D182V probably benign Het
Tubgcp2 T A 7: 140,004,876 T549S probably benign Het
Vim A T 2: 13,574,337 probably benign Het
Vmn2r118 C A 17: 55,592,837 R689I probably damaging Het
Zbtb41 A T 1: 139,447,517 E905V probably damaging Het
Zfyve9 A T 4: 108,642,091 D1284E possibly damaging Het
Other mutations in Olfr539
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Olfr539 APN 7 140667941 missense probably benign 0.01
IGL01610:Olfr539 APN 7 140667671 missense probably damaging 1.00
IGL02959:Olfr539 APN 7 140667550 missense probably damaging 1.00
IGL03406:Olfr539 APN 7 140667511 missense probably damaging 1.00
R0671:Olfr539 UTSW 7 140667677 missense probably damaging 1.00
R1771:Olfr539 UTSW 7 140668135 missense probably benign
R1934:Olfr539 UTSW 7 140668038 nonsense probably null
R1985:Olfr539 UTSW 7 140667821 missense probably damaging 1.00
R2962:Olfr539 UTSW 7 140667949 missense probably benign
R4239:Olfr539 UTSW 7 140667583 missense probably benign 0.07
R4240:Olfr539 UTSW 7 140667583 missense probably benign 0.07
R4360:Olfr539 UTSW 7 140667817 missense probably damaging 0.98
R4841:Olfr539 UTSW 7 140667589 missense probably damaging 1.00
R4842:Olfr539 UTSW 7 140667589 missense probably damaging 1.00
R4851:Olfr539 UTSW 7 140667313 missense probably benign
R5325:Olfr539 UTSW 7 140667792 missense probably benign 0.33
R5766:Olfr539 UTSW 7 140667353 missense probably benign 0.02
R6363:Olfr539 UTSW 7 140668082 missense possibly damaging 0.93
R6836:Olfr539 UTSW 7 140668180 missense possibly damaging 0.86
R7777:Olfr539 UTSW 7 140667941 missense probably benign 0.01
R7920:Olfr539 UTSW 7 140667901 missense possibly damaging 0.92
R8134:Olfr539 UTSW 7 140667767 missense possibly damaging 0.90
R8712:Olfr539 UTSW 7 140668139 missense possibly damaging 0.89
R9095:Olfr539 UTSW 7 140667900 missense probably damaging 1.00
R9158:Olfr539 UTSW 7 140667634 missense possibly damaging 0.76
Predicted Primers PCR Primer
(F):5'- TGACCGCTATGTGGCTATCTG -3'
(R):5'- TGAGTAGTACACAGAGACCACAATG -3'

Sequencing Primer
(F):5'- TCCCCTACACTACAGCTCTAGGATG -3'
(R):5'- TACACAGAGACCACAATGAGGTG -3'
Posted On 2022-09-12