Incidental Mutation 'R9603:Cdkn2d'
ID 723796
Institutional Source Beutler Lab
Gene Symbol Cdkn2d
Ensembl Gene ENSMUSG00000096472
Gene Name cyclin dependent kinase inhibitor 2D
Synonyms p19, p19INK4d, INK4d, INK4d
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.186) question?
Stock # R9603 (G1)
Quality Score 204.009
Status Not validated
Chromosome 9
Chromosomal Location 21288410-21291407 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 21290843 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 36 (D36G)
Ref Sequence ENSEMBL: ENSMUSP00000150701 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003397] [ENSMUST00000038671] [ENSMUST00000086374] [ENSMUST00000115433] [ENSMUST00000184326] [ENSMUST00000213407] [ENSMUST00000213762] [ENSMUST00000215619]
AlphaFold Q60773
Predicted Effect probably benign
Transcript: ENSMUST00000003397
SMART Domains Protein: ENSMUSP00000003397
Gene: ENSMUSG00000003309

DomainStartEndE-ValueType
Pfam:Clat_adaptor_s 2 141 7.3e-9 PFAM
Pfam:Adap_comp_sub 157 422 7.3e-93 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000038671
SMART Domains Protein: ENSMUSP00000039688
Gene: ENSMUSG00000035047

DomainStartEndE-ValueType
low complexity region 20 34 N/A INTRINSIC
low complexity region 50 60 N/A INTRINSIC
low complexity region 98 112 N/A INTRINSIC
low complexity region 181 195 N/A INTRINSIC
Pfam:Kri1 346 439 3.2e-27 PFAM
Pfam:Kri1_C 507 595 8.4e-37 PFAM
low complexity region 653 666 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000086374
AA Change: D36G
SMART Domains Protein: ENSMUSP00000083561
Gene: ENSMUSG00000096472
AA Change: D36G

DomainStartEndE-ValueType
ANK 41 69 1.01e2 SMART
ANK 73 102 1.73e-4 SMART
ANK 106 134 8.89e1 SMART
Blast:ANK 138 166 1e-9 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000115433
SMART Domains Protein: ENSMUSP00000111093
Gene: ENSMUSG00000003309

DomainStartEndE-ValueType
Pfam:Clat_adaptor_s 2 141 7.4e-9 PFAM
Pfam:Adap_comp_sub 157 424 4.7e-95 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000184326
SMART Domains Protein: ENSMUSP00000139184
Gene: ENSMUSG00000035047

DomainStartEndE-ValueType
low complexity region 57 71 N/A INTRINSIC
Pfam:Kri1 207 317 4.4e-27 PFAM
Pfam:Kri1_C 381 472 3.6e-36 PFAM
low complexity region 529 542 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000213407
AA Change: D36G

PolyPhen 2 Score 0.908 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect probably benign
Transcript: ENSMUST00000213762
Predicted Effect possibly damaging
Transcript: ENSMUST00000215619
AA Change: D36G

PolyPhen 2 Score 0.908 (Sensitivity: 0.81; Specificity: 0.94)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the INK4 family of cyclin-dependent kinase inhibitors. This protein has been shown to form a stable complex with CDK4 or CDK6, and prevent the activation of the CDK kinases, thus function as a cell growth regulator that controls cell cycle G1 progression. The abundance of the transcript of this gene was found to oscillate in a cell-cycle dependent manner with the lowest expression at mid G1 and a maximal expression during S phase. The negative regulation of the cell cycle involved in this protein was shown to participate in repressing neuronal proliferation, as well as spermatogenesis. Two alternatively spliced variants of this gene, which encode an identical protein, have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Both female and male homozygous null mice are fertile in spite of testicular atrophy and increased male germ cell apoptosis due to delayed meiosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik T C 7: 131,228,914 V359A probably damaging Het
Acsl6 A T 11: 54,335,085 N317I probably damaging Het
Adam18 T A 8: 24,628,131 S590C possibly damaging Het
Btrc G A 19: 45,471,087 E103K probably benign Het
Cars A G 7: 143,559,192 M766T possibly damaging Het
Cavin4 T C 4: 48,671,999 V148A probably benign Het
Cubn A T 2: 13,287,699 D3224E probably damaging Het
Ebf1 A G 11: 44,618,179 M1V probably null Het
Fcgbp A G 7: 28,103,138 D1497G probably damaging Het
Foxs1 A C 2: 152,932,361 C257W probably damaging Het
Fstl5 C T 3: 76,588,953 P341L probably damaging Het
Fzd10 G A 5: 128,601,707 G164S probably benign Het
Gm13103 T C 4: 143,851,697 S176P Het
Gm5662 T G 12: 88,271,957 N11T unknown Het
Hrh3 C A 2: 180,100,651 E395* probably null Het
Hsf4 G A 8: 105,272,803 V318M probably damaging Het
Il21 T C 3: 37,227,800 E65G possibly damaging Het
Kank1 A G 19: 25,430,925 D1256G possibly damaging Het
Klhl22 A G 16: 17,777,051 N348S possibly damaging Het
Krr1 T C 10: 111,976,767 I94T probably damaging Het
Lpin2 A G 17: 71,243,415 D724G probably damaging Het
Mn1 C A 5: 111,418,527 P121Q probably damaging Het
Mphosph9 A T 5: 124,324,952 L10* probably null Het
Mtus1 A T 8: 41,083,758 V307E probably benign Het
Muc20 A G 16: 32,794,785 L74P probably damaging Het
Nnat A G 2: 157,561,781 *113W probably null Het
Olfr1306 A G 2: 111,912,783 V49A possibly damaging Het
Olfr38 C T 6: 42,762,738 Q229* probably null Het
Olfr539 G T 7: 140,667,881 C191F probably damaging Het
Olfr711 A T 7: 106,971,896 Y149* probably null Het
Pkm T A 9: 59,670,548 V216E probably damaging Het
Pla2g12a G A 3: 129,881,251 V19I unknown Het
Rai14 G A 15: 10,595,030 Q136* probably null Het
Rnf150 T A 8: 82,990,579 N238K possibly damaging Het
Rrp1 A G 10: 78,404,923 probably null Het
Scaf8 T A 17: 3,195,795 L720M possibly damaging Het
Slamf1 G T 1: 171,798,203 V316L probably damaging Het
Slc14a1 C A 18: 78,109,592 A367S probably damaging Het
Slc25a20 T C 9: 108,672,476 F86L probably benign Het
Slc4a5 T G 6: 83,240,732 S131A probably benign Het
Slitrk3 A G 3: 73,051,316 I41T probably benign Het
Sntg1 A T 1: 8,677,974 L94Q probably damaging Het
St18 T C 1: 6,845,587 C819R probably damaging Het
St6galnac3 T A 3: 153,411,540 D182V probably benign Het
Tubgcp2 T A 7: 140,004,876 T549S probably benign Het
Vim A T 2: 13,574,337 probably benign Het
Vmn2r118 C A 17: 55,592,837 R689I probably damaging Het
Zbtb41 A T 1: 139,447,517 E905V probably damaging Het
Zfyve9 A T 4: 108,642,091 D1284E possibly damaging Het
Other mutations in Cdkn2d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02516:Cdkn2d APN 9 21289143 missense probably benign 0.04
R0238:Cdkn2d UTSW 9 21290992 start gained probably benign
R0238:Cdkn2d UTSW 9 21290992 start gained probably benign
R2064:Cdkn2d UTSW 9 21290879 missense probably damaging 1.00
R4454:Cdkn2d UTSW 9 21290889 missense probably benign
R4455:Cdkn2d UTSW 9 21290889 missense probably benign
R4456:Cdkn2d UTSW 9 21290889 missense probably benign
R4457:Cdkn2d UTSW 9 21290889 missense probably benign
R4458:Cdkn2d UTSW 9 21290889 missense probably benign
R4462:Cdkn2d UTSW 9 21290889 missense probably benign
R4463:Cdkn2d UTSW 9 21290889 missense probably benign
R4735:Cdkn2d UTSW 9 21290889 missense probably benign
R4854:Cdkn2d UTSW 9 21290927 missense probably benign
R5493:Cdkn2d UTSW 9 21289007 missense probably benign 0.00
R7560:Cdkn2d UTSW 9 21289244 missense probably damaging 1.00
R8117:Cdkn2d UTSW 9 21289151 missense probably benign 0.01
R9762:Cdkn2d UTSW 9 21289087 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCTATTAGACAAGAGCTGAAAAGCC -3'
(R):5'- GCAGTCCCTAGAGTTCTGATCC -3'

Sequencing Primer
(F):5'- GAGCTGAAAAGCCATCCCCTC -3'
(R):5'- AGAGTTCTGATCCAGCTCTTG -3'
Posted On 2022-09-12