Mutagenetix > Incidental Mutation

Incidental Mutation 'R9603:Scaf8'

723807

Institutional Source

Beutler Lab

Gene Symbol

Scaf8

Ensembl Gene

ENSMUSG00000046201

Gene Name

SR-related CTD-associated factor 8

Synonyms

Rbm16, A630086M08Rik, A930036P18Rik

MMRRC Submission

Accession Numbers

Essential gene?

Probably essential (E-score: 0.785) question?

Stock #

R9603 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

3114972-3198859 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 3195795 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Methionine at position 720 (L720M)

Ref Sequence

ENSEMBL: ENSMUSP00000076024 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000076734]

AlphaFold

Q6DID3

Predicted Effect

possibly damaging
Transcript: ENSMUST00000076734
AA Change: L720M

PolyPhen 2 Score 0.801 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000076024
Gene: ENSMUSG00000046201
AA Change: L720M

Domain	Start	End	E-Value	Type
RPR	6	136	1.26e-42	SMART
low complexity region	157	171	N/A	INTRINSIC
low complexity region	193	223	N/A	INTRINSIC
low complexity region	232	251	N/A	INTRINSIC
low complexity region	271	282	N/A	INTRINSIC
low complexity region	305	326	N/A	INTRINSIC
low complexity region	363	380	N/A	INTRINSIC
low complexity region	397	462	N/A	INTRINSIC
RRM	478	547	9.2e-14	SMART
low complexity region	644	677	N/A	INTRINSIC
low complexity region	685	712	N/A	INTRINSIC
low complexity region	857	883	N/A	INTRINSIC
low complexity region	941	953	N/A	INTRINSIC
low complexity region	962	971	N/A	INTRINSIC
low complexity region	1027	1044	N/A	INTRINSIC
internal_repeat_1	1048	1064	2e-5	PROSPERO
internal_repeat_1	1059	1075	2e-5	PROSPERO
low complexity region	1146	1168	N/A	INTRINSIC
low complexity region	1249	1268	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5430419D17Rik	T	C	7: 131,228,914	V359A	probably damaging	Het
Acsl6	A	T	11: 54,335,085	N317I	probably damaging	Het
Adam18	T	A	8: 24,628,131	S590C	possibly damaging	Het
Btrc	G	A	19: 45,471,087	E103K	probably benign	Het
Cars	A	G	7: 143,559,192	M766T	possibly damaging	Het
Cavin4	T	C	4: 48,671,999	V148A	probably benign	Het
Cdkn2d	T	C	9: 21,290,843	D36G	possibly damaging	Het
Cubn	A	T	2: 13,287,699	D3224E	probably damaging	Het
Ebf1	A	G	11: 44,618,179	M1V	probably null	Het
Fcgbp	A	G	7: 28,103,138	D1497G	probably damaging	Het
Foxs1	A	C	2: 152,932,361	C257W	probably damaging	Het
Fstl5	C	T	3: 76,588,953	P341L	probably damaging	Het
Fzd10	G	A	5: 128,601,707	G164S	probably benign	Het
Gm13103	T	C	4: 143,851,697	S176P		Het
Gm5662	T	G	12: 88,271,957	N11T	unknown	Het
Hrh3	C	A	2: 180,100,651	E395*	probably null	Het
Hsf4	G	A	8: 105,272,803	V318M	probably damaging	Het
Il21	T	C	3: 37,227,800	E65G	possibly damaging	Het
Kank1	A	G	19: 25,430,925	D1256G	possibly damaging	Het
Klhl22	A	G	16: 17,777,051	N348S	possibly damaging	Het
Krr1	T	C	10: 111,976,767	I94T	probably damaging	Het
Lpin2	A	G	17: 71,243,415	D724G	probably damaging	Het
Mn1	C	A	5: 111,418,527	P121Q	probably damaging	Het
Mphosph9	A	T	5: 124,324,952	L10*	probably null	Het
Mtus1	A	T	8: 41,083,758	V307E	probably benign	Het
Muc20	A	G	16: 32,794,785	L74P	probably damaging	Het
Nnat	A	G	2: 157,561,781	*113W	probably null	Het
Olfr1306	A	G	2: 111,912,783	V49A	possibly damaging	Het
Olfr38	C	T	6: 42,762,738	Q229*	probably null	Het
Olfr539	G	T	7: 140,667,881	C191F	probably damaging	Het
Olfr711	A	T	7: 106,971,896	Y149*	probably null	Het
Pkm	T	A	9: 59,670,548	V216E	probably damaging	Het
Pla2g12a	G	A	3: 129,881,251	V19I	unknown	Het
Rai14	G	A	15: 10,595,030	Q136*	probably null	Het
Rnf150	T	A	8: 82,990,579	N238K	possibly damaging	Het
Rrp1	A	G	10: 78,404,923		probably null	Het
Slamf1	G	T	1: 171,798,203	V316L	probably damaging	Het
Slc14a1	C	A	18: 78,109,592	A367S	probably damaging	Het
Slc25a20	T	C	9: 108,672,476	F86L	probably benign	Het
Slc4a5	T	G	6: 83,240,732	S131A	probably benign	Het
Slitrk3	A	G	3: 73,051,316	I41T	probably benign	Het
Sntg1	A	T	1: 8,677,974	L94Q	probably damaging	Het
St18	T	C	1: 6,845,587	C819R	probably damaging	Het
St6galnac3	T	A	3: 153,411,540	D182V	probably benign	Het
Tubgcp2	T	A	7: 140,004,876	T549S	probably benign	Het
Vim	A	T	2: 13,574,337		probably benign	Het
Vmn2r118	C	A	17: 55,592,837	R689I	probably damaging	Het
Zbtb41	A	T	1: 139,447,517	E905V	probably damaging	Het
Zfyve9	A	T	4: 108,642,091	D1284E	possibly damaging	Het

Other mutations in Scaf8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00496:Scaf8	APN	17	3171134	missense	unknown
IGL00956:Scaf8	APN	17	3171147	missense	unknown
IGL01610:Scaf8	APN	17	3195849	missense	probably damaging	1.00
IGL01967:Scaf8	APN	17	3196938	missense	possibly damaging	0.91
IGL02005:Scaf8	APN	17	3185870	missense	probably damaging	1.00
IGL03037:Scaf8	APN	17	3190221	missense	probably damaging	0.99
BB004:Scaf8	UTSW	17	3159220	missense	unknown
BB014:Scaf8	UTSW	17	3159220	missense	unknown
R0320:Scaf8	UTSW	17	3178255	missense	unknown
R0789:Scaf8	UTSW	17	3196837	missense	possibly damaging	0.94
R0850:Scaf8	UTSW	17	3195774	splice site	probably null
R0919:Scaf8	UTSW	17	3197120	missense	probably damaging	1.00
R1488:Scaf8	UTSW	17	3197597	missense	probably damaging	0.97
R1544:Scaf8	UTSW	17	3145154	missense	probably damaging	0.96
R1928:Scaf8	UTSW	17	3168077	missense	unknown
R1972:Scaf8	UTSW	17	3169371	missense	unknown
R2156:Scaf8	UTSW	17	3164132	splice site	probably null
R2164:Scaf8	UTSW	17	3197210	missense	probably damaging	1.00
R2680:Scaf8	UTSW	17	3197591	missense	possibly damaging	0.95
R3794:Scaf8	UTSW	17	3190249	missense	probably damaging	1.00
R4368:Scaf8	UTSW	17	3171195	missense	unknown
R4673:Scaf8	UTSW	17	3197985	missense	probably benign	0.04
R4694:Scaf8	UTSW	17	3197404	missense	probably damaging	1.00
R4716:Scaf8	UTSW	17	3177123	missense	unknown
R4852:Scaf8	UTSW	17	3178219	missense	unknown
R5036:Scaf8	UTSW	17	3164262	unclassified	probably benign
R5193:Scaf8	UTSW	17	3190165	missense	probably benign	0.02
R5429:Scaf8	UTSW	17	3197110	missense	probably benign	0.14
R5816:Scaf8	UTSW	17	3177713	missense	unknown
R6050:Scaf8	UTSW	17	3168108	missense	unknown
R6493:Scaf8	UTSW	17	3171119	missense	unknown
R6616:Scaf8	UTSW	17	3168055	missense	unknown
R7065:Scaf8	UTSW	17	3159211	missense	probably damaging	1.00
R7112:Scaf8	UTSW	17	3163029	missense	unknown
R7141:Scaf8	UTSW	17	3159182	missense	unknown
R7198:Scaf8	UTSW	17	3163098	missense	unknown
R7265:Scaf8	UTSW	17	3177625	missense	unknown
R7592:Scaf8	UTSW	17	3171222	critical splice donor site	probably null
R7711:Scaf8	UTSW	17	3187634	missense	probably damaging	0.97
R7813:Scaf8	UTSW	17	3197274	missense	probably damaging	1.00
R7867:Scaf8	UTSW	17	3177719	missense	unknown
R7927:Scaf8	UTSW	17	3159220	missense	unknown
R7937:Scaf8	UTSW	17	3197207	missense	probably damaging	0.99
R7958:Scaf8	UTSW	17	3171122	missense	unknown
R7960:Scaf8	UTSW	17	3171122	missense	unknown
R8024:Scaf8	UTSW	17	3159293	missense	unknown
R8118:Scaf8	UTSW	17	3164183	missense	unknown
R8285:Scaf8	UTSW	17	3177129	missense	unknown
R8303:Scaf8	UTSW	17	3148552	missense	unknown
R8365:Scaf8	UTSW	17	3195966	missense	possibly damaging	0.67
R8544:Scaf8	UTSW	17	3163020	unclassified	probably benign
R8768:Scaf8	UTSW	17	3193074	missense	probably benign	0.27
R9520:Scaf8	UTSW	17	3198010	missense	probably damaging	1.00
R9521:Scaf8	UTSW	17	3198010	missense	probably damaging	1.00
R9622:Scaf8	UTSW	17	3197895	missense	probably benign	0.21
R9687:Scaf8	UTSW	17	3171135	missense	unknown
Z1088:Scaf8	UTSW	17	3162983	unclassified	probably benign
Z1177:Scaf8	UTSW	17	3162994	missense	unknown

Predicted Primers

PCR Primer
(F):5'- AGCTGCCTCATTATGACTAGTC -3'
(R):5'- TCTAAGGTTTTGGTCACGGC -3'

Sequencing Primer
(F):5'- GTCATTTTAAGCATTGGTTATTGCAC -3'
(R):5'- GTCTTGTGTTCTCACCAGAAGGAATC -3'

Posted On

2022-09-12