Incidental Mutation 'R9603:Vmn2r118'
ID 723808
Institutional Source Beutler Lab
Gene Symbol Vmn2r118
Ensembl Gene ENSMUSG00000091504
Gene Name vomeronasal 2, receptor 118
Synonyms Vmn2r119, EG668547, EG383258
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.128) question?
Stock # R9603 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 55899341-55931672 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 55899837 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Isoleucine at position 689 (R689I)
Ref Sequence ENSEMBL: ENSMUSP00000131128 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168440]
AlphaFold E9Q1C1
Predicted Effect probably damaging
Transcript: ENSMUST00000168440
AA Change: R689I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000131128
Gene: ENSMUSG00000091504
AA Change: R689I

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 142 470 4.6e-27 PFAM
Pfam:NCD3G 513 566 2.6e-20 PFAM
Pfam:7tm_3 599 834 5.9e-55 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl6 A T 11: 54,225,911 (GRCm39) N317I probably damaging Het
Adam18 T A 8: 25,118,147 (GRCm39) S590C possibly damaging Het
Btrc G A 19: 45,459,526 (GRCm39) E103K probably benign Het
Cars1 A G 7: 143,112,929 (GRCm39) M766T possibly damaging Het
Cavin4 T C 4: 48,671,999 (GRCm39) V148A probably benign Het
Cdcp3 T C 7: 130,830,643 (GRCm39) V359A probably damaging Het
Cdkn2d T C 9: 21,202,139 (GRCm39) D36G possibly damaging Het
Cubn A T 2: 13,292,510 (GRCm39) D3224E probably damaging Het
Ebf1 A G 11: 44,509,006 (GRCm39) M1V probably null Het
Eif1ad7 T G 12: 88,238,727 (GRCm39) N11T unknown Het
Fcgbp A G 7: 27,802,563 (GRCm39) D1497G probably damaging Het
Foxs1 A C 2: 152,774,281 (GRCm39) C257W probably damaging Het
Fstl5 C T 3: 76,496,260 (GRCm39) P341L probably damaging Het
Fzd10 G A 5: 128,678,771 (GRCm39) G164S probably benign Het
Hrh3 C A 2: 179,742,444 (GRCm39) E395* probably null Het
Hsf4 G A 8: 105,999,435 (GRCm39) V318M probably damaging Het
Il21 T C 3: 37,281,949 (GRCm39) E65G possibly damaging Het
Kank1 A G 19: 25,408,289 (GRCm39) D1256G possibly damaging Het
Klhl22 A G 16: 17,594,915 (GRCm39) N348S possibly damaging Het
Krr1 T C 10: 111,812,672 (GRCm39) I94T probably damaging Het
Lpin2 A G 17: 71,550,410 (GRCm39) D724G probably damaging Het
Mn1 C A 5: 111,566,393 (GRCm39) P121Q probably damaging Het
Mphosph9 A T 5: 124,463,015 (GRCm39) L10* probably null Het
Mtus1 A T 8: 41,536,795 (GRCm39) V307E probably benign Het
Muc20 A G 16: 32,615,155 (GRCm39) L74P probably damaging Het
Nnat A G 2: 157,403,701 (GRCm39) *113W probably null Het
Or13a25 G T 7: 140,247,794 (GRCm39) C191F probably damaging Het
Or2f1b C T 6: 42,739,672 (GRCm39) Q229* probably null Het
Or4f14 A G 2: 111,743,128 (GRCm39) V49A possibly damaging Het
Or6b6 A T 7: 106,571,103 (GRCm39) Y149* probably null Het
Pkm T A 9: 59,577,831 (GRCm39) V216E probably damaging Het
Pla2g12a G A 3: 129,674,900 (GRCm39) V19I unknown Het
Pramel27 T C 4: 143,578,267 (GRCm39) S176P Het
Rai14 G A 15: 10,595,116 (GRCm39) Q136* probably null Het
Rnf150 T A 8: 83,717,208 (GRCm39) N238K possibly damaging Het
Rrp1 A G 10: 78,240,757 (GRCm39) probably null Het
Scaf8 T A 17: 3,246,070 (GRCm39) L720M possibly damaging Het
Slamf1 G T 1: 171,625,771 (GRCm39) V316L probably damaging Het
Slc14a1 C A 18: 78,152,807 (GRCm39) A367S probably damaging Het
Slc25a20 T C 9: 108,549,675 (GRCm39) F86L probably benign Het
Slc4a5 T G 6: 83,217,714 (GRCm39) S131A probably benign Het
Slitrk3 A G 3: 72,958,649 (GRCm39) I41T probably benign Het
Sntg1 A T 1: 8,748,198 (GRCm39) L94Q probably damaging Het
St18 T C 1: 6,915,811 (GRCm39) C819R probably damaging Het
St6galnac3 T A 3: 153,117,177 (GRCm39) D182V probably benign Het
Tubgcp2 T A 7: 139,584,789 (GRCm39) T549S probably benign Het
Vim A T 2: 13,579,148 (GRCm39) probably benign Het
Zbtb41 A T 1: 139,375,255 (GRCm39) E905V probably damaging Het
Zfyve9 A T 4: 108,499,288 (GRCm39) D1284E possibly damaging Het
Other mutations in Vmn2r118
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Vmn2r118 APN 17 55,899,708 (GRCm39) missense probably damaging 1.00
IGL00976:Vmn2r118 APN 17 55,900,204 (GRCm39) missense probably damaging 1.00
IGL01419:Vmn2r118 APN 17 55,900,000 (GRCm39) missense probably benign 0.01
IGL01796:Vmn2r118 APN 17 55,915,585 (GRCm39) missense probably benign 0.30
IGL01799:Vmn2r118 APN 17 55,899,990 (GRCm39) missense probably damaging 1.00
IGL02002:Vmn2r118 APN 17 55,899,619 (GRCm39) missense probably damaging 1.00
IGL02075:Vmn2r118 APN 17 55,917,517 (GRCm39) missense probably benign 0.18
IGL02172:Vmn2r118 APN 17 55,931,598 (GRCm39) missense probably benign 0.00
IGL02529:Vmn2r118 APN 17 55,917,870 (GRCm39) missense possibly damaging 0.58
IGL02712:Vmn2r118 APN 17 55,899,655 (GRCm39) missense probably benign 0.21
IGL03096:Vmn2r118 APN 17 55,914,996 (GRCm39) missense probably damaging 1.00
R0306:Vmn2r118 UTSW 17 55,915,616 (GRCm39) missense possibly damaging 0.89
R0329:Vmn2r118 UTSW 17 55,917,717 (GRCm39) missense probably damaging 1.00
R0330:Vmn2r118 UTSW 17 55,917,717 (GRCm39) missense probably damaging 1.00
R0396:Vmn2r118 UTSW 17 55,915,643 (GRCm39) missense probably benign 0.00
R0411:Vmn2r118 UTSW 17 55,918,021 (GRCm39) splice site probably benign
R0513:Vmn2r118 UTSW 17 55,917,970 (GRCm39) nonsense probably null
R0627:Vmn2r118 UTSW 17 55,917,772 (GRCm39) missense probably benign 0.01
R0638:Vmn2r118 UTSW 17 55,915,466 (GRCm39) missense probably benign 0.03
R1328:Vmn2r118 UTSW 17 55,915,620 (GRCm39) missense probably benign 0.01
R1366:Vmn2r118 UTSW 17 55,900,237 (GRCm39) nonsense probably null
R1465:Vmn2r118 UTSW 17 55,917,935 (GRCm39) missense probably benign 0.33
R1465:Vmn2r118 UTSW 17 55,917,935 (GRCm39) missense probably benign 0.33
R1511:Vmn2r118 UTSW 17 55,915,496 (GRCm39) nonsense probably null
R1515:Vmn2r118 UTSW 17 55,917,643 (GRCm39) missense probably benign 0.25
R1550:Vmn2r118 UTSW 17 55,915,083 (GRCm39) missense probably damaging 1.00
R1779:Vmn2r118 UTSW 17 55,918,530 (GRCm39) missense probably benign 0.03
R1834:Vmn2r118 UTSW 17 55,899,456 (GRCm39) missense probably damaging 1.00
R1840:Vmn2r118 UTSW 17 55,917,406 (GRCm39) nonsense probably null
R1854:Vmn2r118 UTSW 17 55,918,556 (GRCm39) missense possibly damaging 0.57
R1967:Vmn2r118 UTSW 17 55,899,882 (GRCm39) missense probably damaging 1.00
R1976:Vmn2r118 UTSW 17 55,899,925 (GRCm39) missense probably damaging 1.00
R2308:Vmn2r118 UTSW 17 55,931,650 (GRCm39) missense probably benign 0.33
R3700:Vmn2r118 UTSW 17 55,915,421 (GRCm39) missense possibly damaging 0.68
R4334:Vmn2r118 UTSW 17 55,917,347 (GRCm39) missense possibly damaging 0.58
R4647:Vmn2r118 UTSW 17 55,917,665 (GRCm39) missense probably damaging 1.00
R4709:Vmn2r118 UTSW 17 55,917,860 (GRCm39) missense probably damaging 1.00
R4805:Vmn2r118 UTSW 17 55,899,581 (GRCm39) missense probably damaging 1.00
R4858:Vmn2r118 UTSW 17 55,899,894 (GRCm39) missense probably damaging 0.98
R5384:Vmn2r118 UTSW 17 55,918,565 (GRCm39) missense probably benign 0.00
R5385:Vmn2r118 UTSW 17 55,918,565 (GRCm39) missense probably benign 0.00
R5664:Vmn2r118 UTSW 17 55,899,765 (GRCm39) missense possibly damaging 0.46
R5740:Vmn2r118 UTSW 17 55,900,103 (GRCm39) missense probably benign 0.00
R5927:Vmn2r118 UTSW 17 55,931,494 (GRCm39) missense probably benign 0.04
R6143:Vmn2r118 UTSW 17 55,899,871 (GRCm39) missense possibly damaging 0.92
R6513:Vmn2r118 UTSW 17 55,915,093 (GRCm39) missense probably damaging 1.00
R6573:Vmn2r118 UTSW 17 55,899,996 (GRCm39) missense probably damaging 1.00
R6760:Vmn2r118 UTSW 17 55,899,714 (GRCm39) missense possibly damaging 0.92
R6794:Vmn2r118 UTSW 17 55,899,348 (GRCm39) missense possibly damaging 0.48
R6929:Vmn2r118 UTSW 17 55,917,440 (GRCm39) missense probably benign 0.01
R7201:Vmn2r118 UTSW 17 55,915,496 (GRCm39) nonsense probably null
R7539:Vmn2r118 UTSW 17 55,899,853 (GRCm39) missense probably damaging 0.98
R7836:Vmn2r118 UTSW 17 55,900,242 (GRCm39) missense probably damaging 0.99
R8179:Vmn2r118 UTSW 17 55,915,484 (GRCm39) missense probably benign 0.36
R8248:Vmn2r118 UTSW 17 55,917,936 (GRCm39) missense probably benign 0.18
R8347:Vmn2r118 UTSW 17 55,917,423 (GRCm39) missense possibly damaging 0.94
R8415:Vmn2r118 UTSW 17 55,915,057 (GRCm39) missense probably benign 0.08
R8428:Vmn2r118 UTSW 17 55,915,642 (GRCm39) missense probably benign 0.33
R8917:Vmn2r118 UTSW 17 55,917,216 (GRCm39) missense possibly damaging 0.82
R8993:Vmn2r118 UTSW 17 55,917,835 (GRCm39) missense possibly damaging 0.72
R9038:Vmn2r118 UTSW 17 55,918,649 (GRCm39) missense probably damaging 1.00
R9155:Vmn2r118 UTSW 17 55,917,207 (GRCm39) missense probably null 0.83
R9742:Vmn2r118 UTSW 17 55,918,009 (GRCm39) missense probably damaging 0.98
R9749:Vmn2r118 UTSW 17 55,915,415 (GRCm39) critical splice donor site probably null
R9792:Vmn2r118 UTSW 17 55,899,496 (GRCm39) missense probably damaging 0.99
R9793:Vmn2r118 UTSW 17 55,899,496 (GRCm39) missense probably damaging 0.99
R9795:Vmn2r118 UTSW 17 55,899,496 (GRCm39) missense probably damaging 0.99
X0022:Vmn2r118 UTSW 17 55,900,218 (GRCm39) missense probably damaging 1.00
Z1176:Vmn2r118 UTSW 17 55,917,655 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCCCAGCACAGAGTAGAAGG -3'
(R):5'- GTGAAAGCTAATAACCGCACTCTC -3'

Sequencing Primer
(F):5'- GCTATAAGTGAGCCCTTGTTGCAC -3'
(R):5'- GCACTCTCAGCTACATCCTG -3'
Posted On 2022-09-12