Incidental Mutation 'R9606:Ndc1'
ID 723859
Institutional Source Beutler Lab
Gene Symbol Ndc1
Ensembl Gene ENSMUSG00000028614
Gene Name NDC1 transmembrane nucleoporin
Synonyms sks, 2810475A17Rik, Tmem48
MMRRC Submission
Accession Numbers
Essential gene? Probably essential (E-score: 0.947) question?
Stock # R9606 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 107225244-107273543 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 107246686 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Serine at position 370 (C370S)
Ref Sequence ENSEMBL: ENSMUSP00000120365 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030357] [ENSMUST00000125342] [ENSMUST00000139560] [ENSMUST00000149366]
AlphaFold Q8VCB1
Predicted Effect probably benign
Transcript: ENSMUST00000030357
Predicted Effect probably benign
Transcript: ENSMUST00000125342
Predicted Effect probably damaging
Transcript: ENSMUST00000139560
AA Change: C370S

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000120365
Gene: ENSMUSG00000028614
AA Change: C370S

DomainStartEndE-ValueType
Pfam:Ndc1_Nup 20 666 1.7e-137 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000149366
AA Change: C370S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000137180
Gene: ENSMUSG00000028614
AA Change: C370S

DomainStartEndE-ValueType
Pfam:Ndc1_Nup 19 511 3.7e-136 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mutations in this gene produce background sensitive growth rates and skeletal anomalies. Both females and males are sterile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430548M08Rik A G 8: 120,880,706 (GRCm39) Y286C probably damaging Het
Cacna1c T C 6: 118,587,455 (GRCm39) T1657A Het
Ccs A T 19: 4,882,897 (GRCm39) D151E probably benign Het
Cfap74 A G 4: 155,509,133 (GRCm39) T295A Het
Chmp4c A T 3: 10,432,222 (GRCm39) E44V probably damaging Het
Crybg2 A T 4: 133,801,383 (GRCm39) K539* probably null Het
Dgkg T C 16: 22,441,011 (GRCm39) M1V probably null Het
E2f2 T A 4: 135,911,743 (GRCm39) Y251* probably null Het
Fat2 T C 11: 55,180,093 (GRCm39) Y1416C probably damaging Het
Fgl2 T C 5: 21,577,991 (GRCm39) S93P possibly damaging Het
Hivep3 C T 4: 119,989,786 (GRCm39) T2079I probably damaging Het
Igfl3 A C 7: 17,913,920 (GRCm39) K90T possibly damaging Het
Lsamp A G 16: 41,709,292 (GRCm39) D74G probably benign Het
Mmrn2 C A 14: 34,119,654 (GRCm39) T211K possibly damaging Het
Mov10 A T 3: 104,707,664 (GRCm39) V570D probably benign Het
Mrc1 A T 2: 14,313,517 (GRCm39) Y916F probably benign Het
Myo10 CAGGTATAAAG CAG 15: 25,776,401 (GRCm39) probably null Het
Nln TGGTCCAGGTAAAACTGCCCCAGCCAATCAGGTACCTTGGATAGAGGTCCAGGTAAAACTGCCCCAGCCAATCAGGTACCTTGGATAGAGGTCCAGGTAGAACTGCCCCAGC TGGTCCAGGTAAAACTGCCCCAGCCAATCAGGTACCTTGGATAGAGGTCCAGGTAGAACTGCCCCAGC 13: 104,186,924 (GRCm39) probably null Het
Nrcam A T 12: 44,609,240 (GRCm39) N455I probably damaging Het
Nrp1 G A 8: 129,229,029 (GRCm39) E836K probably benign Het
Or2t29 C T 11: 58,433,753 (GRCm39) C196Y probably damaging Het
Or5b120 A T 19: 13,479,943 (GRCm39) K79* probably null Het
Or6c216 A T 10: 129,678,625 (GRCm39) C95* probably null Het
Or8b1d A G 9: 38,558,620 (GRCm39) S67P probably damaging Het
Pcca T C 14: 122,901,717 (GRCm39) S287P probably damaging Het
Pitpnm3 T A 11: 71,955,069 (GRCm39) T482S probably benign Het
Pld2 C T 11: 70,445,893 (GRCm39) R676* probably null Het
Ppm1k T C 6: 57,491,057 (GRCm39) Y286C possibly damaging Het
Rb1 T C 14: 73,517,573 (GRCm39) N278D probably damaging Het
Sema3g T C 14: 30,943,783 (GRCm39) L221P probably damaging Het
Skint2 C T 4: 112,483,147 (GRCm39) T184I probably benign Het
Slc38a2 A G 15: 96,591,172 (GRCm39) F232S probably damaging Het
Snx6 T C 12: 54,814,811 (GRCm39) N170S probably benign Het
Sox9 T A 11: 112,673,416 (GRCm39) N2K probably damaging Het
Sp140l1 G C 1: 85,075,344 (GRCm39) probably null Het
Srpk2 T C 5: 23,729,604 (GRCm39) E345G probably benign Het
Tbc1d21 T C 9: 58,268,487 (GRCm39) M291V possibly damaging Het
Tekt2 T C 4: 126,218,693 (GRCm39) N20S probably benign Het
Tnxb T G 17: 34,914,578 (GRCm39) I1888S possibly damaging Het
Tsnaxip1 G A 8: 106,566,685 (GRCm39) E174K probably damaging Het
Ttc28 G A 5: 111,433,140 (GRCm39) R2058Q probably benign Het
Ttn C T 2: 76,715,357 (GRCm39) E7912K unknown Het
Ttyh2 T A 11: 114,601,667 (GRCm39) D430E probably benign Het
Ubr2 C T 17: 47,245,020 (GRCm39) G1669R probably damaging Het
Vcan A T 13: 89,853,491 (GRCm39) S490T probably damaging Het
Vmn1r86 T A 7: 12,836,741 (GRCm39) D45V probably damaging Het
Wdr12 A G 1: 60,127,226 (GRCm39) V143A possibly damaging Het
Zbtb18 T A 1: 177,274,989 (GRCm39) Y116* probably null Het
Zdbf2 C T 1: 63,342,536 (GRCm39) T305I possibly damaging Het
Zfp384 T A 6: 125,007,802 (GRCm39) M244K possibly damaging Het
Zfp423 A T 8: 88,414,595 (GRCm39) V1241D probably damaging Het
Zfp574 A G 7: 24,780,640 (GRCm39) Y554C probably damaging Het
Zfp616 T C 11: 73,976,220 (GRCm39) S830P probably damaging Het
Zfp839 A G 12: 110,834,776 (GRCm39) Y677C probably benign Het
Other mutations in Ndc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00927:Ndc1 APN 4 107,241,977 (GRCm39) splice site probably benign
IGL00929:Ndc1 APN 4 107,246,694 (GRCm39) missense probably benign 0.23
IGL01340:Ndc1 APN 4 107,231,344 (GRCm39) missense probably damaging 1.00
IGL01376:Ndc1 APN 4 107,232,394 (GRCm39) missense probably damaging 1.00
IGL01954:Ndc1 APN 4 107,253,001 (GRCm39) missense probably damaging 1.00
IGL02290:Ndc1 APN 4 107,252,192 (GRCm39) splice site probably benign
IGL03251:Ndc1 APN 4 107,237,856 (GRCm39) missense possibly damaging 0.50
R1168:Ndc1 UTSW 4 107,253,009 (GRCm39) missense probably benign 0.02
R1541:Ndc1 UTSW 4 107,228,485 (GRCm39) nonsense probably null
R1605:Ndc1 UTSW 4 107,225,293 (GRCm39) missense probably damaging 0.96
R1612:Ndc1 UTSW 4 107,252,265 (GRCm39) splice site probably benign
R1716:Ndc1 UTSW 4 107,241,992 (GRCm39) missense probably damaging 1.00
R3522:Ndc1 UTSW 4 107,250,355 (GRCm39) missense probably damaging 0.99
R4036:Ndc1 UTSW 4 107,268,269 (GRCm39) missense probably benign 0.22
R4698:Ndc1 UTSW 4 107,268,334 (GRCm39) missense probably benign 0.06
R4794:Ndc1 UTSW 4 107,247,419 (GRCm39) missense probably benign 0.03
R5053:Ndc1 UTSW 4 107,231,415 (GRCm39) missense probably damaging 1.00
R5097:Ndc1 UTSW 4 107,231,358 (GRCm39) missense probably benign 0.01
R5158:Ndc1 UTSW 4 107,232,362 (GRCm39) missense probably damaging 1.00
R5217:Ndc1 UTSW 4 107,246,773 (GRCm39) missense probably benign
R5579:Ndc1 UTSW 4 107,237,901 (GRCm39) missense possibly damaging 0.74
R5666:Ndc1 UTSW 4 107,246,723 (GRCm39) missense possibly damaging 0.52
R5855:Ndc1 UTSW 4 107,240,904 (GRCm39) missense probably damaging 1.00
R6180:Ndc1 UTSW 4 107,268,395 (GRCm39) missense possibly damaging 0.65
R6525:Ndc1 UTSW 4 107,225,304 (GRCm39) missense probably benign 0.01
R8065:Ndc1 UTSW 4 107,247,595 (GRCm39) missense probably benign 0.01
R8067:Ndc1 UTSW 4 107,247,595 (GRCm39) missense probably benign 0.01
R8100:Ndc1 UTSW 4 107,240,802 (GRCm39) missense possibly damaging 0.94
R8428:Ndc1 UTSW 4 107,226,017 (GRCm39) missense probably benign 0.00
R8952:Ndc1 UTSW 4 107,247,623 (GRCm39) missense probably benign 0.00
R8953:Ndc1 UTSW 4 107,238,890 (GRCm39) missense probably damaging 1.00
R9489:Ndc1 UTSW 4 107,247,863 (GRCm39) critical splice donor site probably null
Z1176:Ndc1 UTSW 4 107,243,799 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCAAAGTTTTGCTTGCAGGC -3'
(R):5'- CACTTCCCTAGGAAACGGATAC -3'

Sequencing Primer
(F):5'- GGCTTTTGAGCAAATTGATTCAGCC -3'
(R):5'- GGAAACGGATACATTCCCCTTTGTG -3'
Posted On 2022-09-12