Incidental Mutation 'R9606:Zfp384'
ID 723871
Institutional Source Beutler Lab
Gene Symbol Zfp384
Ensembl Gene ENSMUSG00000038346
Gene Name zinc finger protein 384
Synonyms Ciz, C130073D16Rik, Nmp4
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.169) question?
Stock # R9606 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 124986108-125014833 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 125007802 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 244 (M244K)
Ref Sequence ENSEMBL: ENSMUSP00000081296 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046064] [ENSMUST00000054553] [ENSMUST00000084275] [ENSMUST00000088308] [ENSMUST00000112424] [ENSMUST00000112425] [ENSMUST00000112427] [ENSMUST00000112428]
AlphaFold E9Q1A5
Predicted Effect possibly damaging
Transcript: ENSMUST00000046064
AA Change: M275K

PolyPhen 2 Score 0.478 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000037986
Gene: ENSMUSG00000038346
AA Change: M275K

DomainStartEndE-ValueType
low complexity region 188 199 N/A INTRINSIC
ZnF_C2H2 260 282 3.47e0 SMART
ZnF_C2H2 288 310 2.99e-4 SMART
ZnF_C2H2 316 338 1.95e-3 SMART
ZnF_C2H2 344 368 7.37e-4 SMART
ZnF_C2H2 374 396 5.06e-2 SMART
ZnF_C2H2 404 426 3.44e-4 SMART
low complexity region 432 490 N/A INTRINSIC
low complexity region 491 496 N/A INTRINSIC
low complexity region 499 519 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000054553
AA Change: M189K

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000086354
Gene: ENSMUSG00000038346
AA Change: M189K

DomainStartEndE-ValueType
low complexity region 133 144 N/A INTRINSIC
ZnF_C2H2 174 196 7.26e-3 SMART
ZnF_C2H2 202 224 2.99e-4 SMART
ZnF_C2H2 230 252 1.95e-3 SMART
ZnF_C2H2 258 282 7.37e-4 SMART
ZnF_C2H2 288 310 5.06e-2 SMART
ZnF_C2H2 318 340 3.44e-4 SMART
low complexity region 346 404 N/A INTRINSIC
low complexity region 405 410 N/A INTRINSIC
low complexity region 413 433 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000084275
AA Change: M244K

PolyPhen 2 Score 0.846 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000081296
Gene: ENSMUSG00000038346
AA Change: M244K

DomainStartEndE-ValueType
low complexity region 188 199 N/A INTRINSIC
ZnF_C2H2 229 251 7.26e-3 SMART
ZnF_C2H2 257 279 2.99e-4 SMART
ZnF_C2H2 285 307 1.95e-3 SMART
ZnF_C2H2 318 340 7.37e-4 SMART
ZnF_C2H2 346 368 2.95e-3 SMART
ZnF_C2H2 374 398 7.37e-4 SMART
ZnF_C2H2 404 426 5.06e-2 SMART
ZnF_C2H2 434 456 3.44e-4 SMART
low complexity region 462 520 N/A INTRINSIC
low complexity region 521 526 N/A INTRINSIC
low complexity region 529 549 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000088308
AA Change: M244K

PolyPhen 2 Score 0.846 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000085648
Gene: ENSMUSG00000038346
AA Change: M244K

DomainStartEndE-ValueType
low complexity region 188 199 N/A INTRINSIC
ZnF_C2H2 229 251 7.26e-3 SMART
ZnF_C2H2 257 279 2.99e-4 SMART
ZnF_C2H2 285 307 1.95e-3 SMART
ZnF_C2H2 318 340 7.37e-4 SMART
ZnF_C2H2 346 368 2.95e-3 SMART
ZnF_C2H2 374 398 7.37e-4 SMART
ZnF_C2H2 404 426 5.06e-2 SMART
ZnF_C2H2 434 456 3.44e-4 SMART
low complexity region 462 520 N/A INTRINSIC
low complexity region 521 526 N/A INTRINSIC
low complexity region 529 549 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000112424
AA Change: M228K

PolyPhen 2 Score 0.918 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000108043
Gene: ENSMUSG00000038346
AA Change: M228K

DomainStartEndE-ValueType
low complexity region 172 183 N/A INTRINSIC
ZnF_C2H2 213 235 7.26e-3 SMART
ZnF_C2H2 241 263 2.99e-4 SMART
ZnF_C2H2 269 291 1.95e-3 SMART
ZnF_C2H2 302 324 7.37e-4 SMART
ZnF_C2H2 330 352 2.95e-3 SMART
ZnF_C2H2 358 382 7.37e-4 SMART
ZnF_C2H2 388 410 5.06e-2 SMART
ZnF_C2H2 418 440 3.44e-4 SMART
low complexity region 446 504 N/A INTRINSIC
low complexity region 505 510 N/A INTRINSIC
low complexity region 513 533 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112425
AA Change: M244K

PolyPhen 2 Score 0.422 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000108044
Gene: ENSMUSG00000038346
AA Change: M244K

DomainStartEndE-ValueType
low complexity region 188 199 N/A INTRINSIC
ZnF_C2H2 229 251 7.26e-3 SMART
ZnF_C2H2 257 279 2.99e-4 SMART
ZnF_C2H2 285 307 1.95e-3 SMART
ZnF_C2H2 313 337 7.37e-4 SMART
ZnF_C2H2 343 365 5.06e-2 SMART
ZnF_C2H2 373 395 3.44e-4 SMART
low complexity region 401 459 N/A INTRINSIC
low complexity region 460 465 N/A INTRINSIC
low complexity region 468 488 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000112427
AA Change: M244K

PolyPhen 2 Score 0.846 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000108046
Gene: ENSMUSG00000038346
AA Change: M244K

DomainStartEndE-ValueType
low complexity region 188 199 N/A INTRINSIC
ZnF_C2H2 229 251 7.26e-3 SMART
ZnF_C2H2 257 279 2.99e-4 SMART
ZnF_C2H2 285 307 1.95e-3 SMART
ZnF_C2H2 318 340 7.37e-4 SMART
ZnF_C2H2 346 368 2.95e-3 SMART
ZnF_C2H2 374 398 7.37e-4 SMART
ZnF_C2H2 404 426 5.06e-2 SMART
ZnF_C2H2 434 456 3.44e-4 SMART
low complexity region 462 520 N/A INTRINSIC
low complexity region 521 526 N/A INTRINSIC
low complexity region 529 549 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000112428
AA Change: M275K

PolyPhen 2 Score 0.478 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000108047
Gene: ENSMUSG00000038346
AA Change: M275K

DomainStartEndE-ValueType
low complexity region 188 199 N/A INTRINSIC
ZnF_C2H2 260 282 3.47e0 SMART
ZnF_C2H2 288 310 2.99e-4 SMART
ZnF_C2H2 316 338 1.95e-3 SMART
ZnF_C2H2 344 368 7.37e-4 SMART
ZnF_C2H2 374 396 5.06e-2 SMART
ZnF_C2H2 404 426 3.44e-4 SMART
low complexity region 432 490 N/A INTRINSIC
low complexity region 491 496 N/A INTRINSIC
low complexity region 499 519 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a C2H2-type zinc finger protein, which may function as a transcription factor. This gene also contains long CAG trinucleotide repeats that encode consecutive glutamine residues. The protein appears to bind and regulate the promoters of the extracellular matrix genes MMP1, MMP3, MMP7 and COL1A1. Studies in mouse suggest that nuclear matrix transcription factors (NP/NMP4) may be part of a general mechanical pathway that couples cell construction and function during extracellular matrix remodeling. Alternative splicing results in multiple transcript variants. Recurrent rearrangements of this gene with the Ewing's sarcoma gene, EWSR1 on chromosome 22, or with the TAF15 gene on chromosome 17, or with the TCF3 (E2A) gene on chromosome 19, have been observed in acute leukemia. A related pseudogene has been identified on chromosome 7. [provided by RefSeq, Apr 2011]
PHENOTYPE: Homozygous mice are small and males have a small testis. Some males develop infertility and exhibit variable degrees of spermatogenic cell degeneration within the seminiferous tubules and increased apoptosis of spermatogenic cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430548M08Rik A G 8: 120,880,706 (GRCm39) Y286C probably damaging Het
Cacna1c T C 6: 118,587,455 (GRCm39) T1657A Het
Ccs A T 19: 4,882,897 (GRCm39) D151E probably benign Het
Cfap74 A G 4: 155,509,133 (GRCm39) T295A Het
Chmp4c A T 3: 10,432,222 (GRCm39) E44V probably damaging Het
Crybg2 A T 4: 133,801,383 (GRCm39) K539* probably null Het
Dgkg T C 16: 22,441,011 (GRCm39) M1V probably null Het
E2f2 T A 4: 135,911,743 (GRCm39) Y251* probably null Het
Fat2 T C 11: 55,180,093 (GRCm39) Y1416C probably damaging Het
Fgl2 T C 5: 21,577,991 (GRCm39) S93P possibly damaging Het
Hivep3 C T 4: 119,989,786 (GRCm39) T2079I probably damaging Het
Igfl3 A C 7: 17,913,920 (GRCm39) K90T possibly damaging Het
Lsamp A G 16: 41,709,292 (GRCm39) D74G probably benign Het
Mmrn2 C A 14: 34,119,654 (GRCm39) T211K possibly damaging Het
Mov10 A T 3: 104,707,664 (GRCm39) V570D probably benign Het
Mrc1 A T 2: 14,313,517 (GRCm39) Y916F probably benign Het
Myo10 CAGGTATAAAG CAG 15: 25,776,401 (GRCm39) probably null Het
Ndc1 T A 4: 107,246,686 (GRCm39) C370S probably damaging Het
Nln TGGTCCAGGTAAAACTGCCCCAGCCAATCAGGTACCTTGGATAGAGGTCCAGGTAAAACTGCCCCAGCCAATCAGGTACCTTGGATAGAGGTCCAGGTAGAACTGCCCCAGC TGGTCCAGGTAAAACTGCCCCAGCCAATCAGGTACCTTGGATAGAGGTCCAGGTAGAACTGCCCCAGC 13: 104,186,924 (GRCm39) probably null Het
Nrcam A T 12: 44,609,240 (GRCm39) N455I probably damaging Het
Nrp1 G A 8: 129,229,029 (GRCm39) E836K probably benign Het
Or2t29 C T 11: 58,433,753 (GRCm39) C196Y probably damaging Het
Or5b120 A T 19: 13,479,943 (GRCm39) K79* probably null Het
Or6c216 A T 10: 129,678,625 (GRCm39) C95* probably null Het
Or8b1d A G 9: 38,558,620 (GRCm39) S67P probably damaging Het
Pcca T C 14: 122,901,717 (GRCm39) S287P probably damaging Het
Pitpnm3 T A 11: 71,955,069 (GRCm39) T482S probably benign Het
Pld2 C T 11: 70,445,893 (GRCm39) R676* probably null Het
Ppm1k T C 6: 57,491,057 (GRCm39) Y286C possibly damaging Het
Rb1 T C 14: 73,517,573 (GRCm39) N278D probably damaging Het
Sema3g T C 14: 30,943,783 (GRCm39) L221P probably damaging Het
Skint2 C T 4: 112,483,147 (GRCm39) T184I probably benign Het
Slc38a2 A G 15: 96,591,172 (GRCm39) F232S probably damaging Het
Snx6 T C 12: 54,814,811 (GRCm39) N170S probably benign Het
Sox9 T A 11: 112,673,416 (GRCm39) N2K probably damaging Het
Sp140l1 G C 1: 85,075,344 (GRCm39) probably null Het
Srpk2 T C 5: 23,729,604 (GRCm39) E345G probably benign Het
Tbc1d21 T C 9: 58,268,487 (GRCm39) M291V possibly damaging Het
Tekt2 T C 4: 126,218,693 (GRCm39) N20S probably benign Het
Tnxb T G 17: 34,914,578 (GRCm39) I1888S possibly damaging Het
Tsnaxip1 G A 8: 106,566,685 (GRCm39) E174K probably damaging Het
Ttc28 G A 5: 111,433,140 (GRCm39) R2058Q probably benign Het
Ttn C T 2: 76,715,357 (GRCm39) E7912K unknown Het
Ttyh2 T A 11: 114,601,667 (GRCm39) D430E probably benign Het
Ubr2 C T 17: 47,245,020 (GRCm39) G1669R probably damaging Het
Vcan A T 13: 89,853,491 (GRCm39) S490T probably damaging Het
Vmn1r86 T A 7: 12,836,741 (GRCm39) D45V probably damaging Het
Wdr12 A G 1: 60,127,226 (GRCm39) V143A possibly damaging Het
Zbtb18 T A 1: 177,274,989 (GRCm39) Y116* probably null Het
Zdbf2 C T 1: 63,342,536 (GRCm39) T305I possibly damaging Het
Zfp423 A T 8: 88,414,595 (GRCm39) V1241D probably damaging Het
Zfp574 A G 7: 24,780,640 (GRCm39) Y554C probably damaging Het
Zfp616 T C 11: 73,976,220 (GRCm39) S830P probably damaging Het
Zfp839 A G 12: 110,834,776 (GRCm39) Y677C probably benign Het
Other mutations in Zfp384
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01335:Zfp384 APN 6 125,002,016 (GRCm39) missense probably benign 0.03
IGL01568:Zfp384 APN 6 125,001,095 (GRCm39) missense probably damaging 1.00
IGL01632:Zfp384 APN 6 125,001,724 (GRCm39) missense probably damaging 1.00
IGL03408:Zfp384 APN 6 125,012,676 (GRCm39) missense probably damaging 1.00
FR4304:Zfp384 UTSW 6 125,013,456 (GRCm39) unclassified probably benign
FR4340:Zfp384 UTSW 6 125,013,426 (GRCm39) unclassified probably benign
R0839:Zfp384 UTSW 6 125,013,631 (GRCm39) missense probably benign 0.01
R1370:Zfp384 UTSW 6 125,013,416 (GRCm39) missense probably benign 0.04
R1427:Zfp384 UTSW 6 125,001,847 (GRCm39) missense probably damaging 1.00
R2441:Zfp384 UTSW 6 125,013,612 (GRCm39) missense probably benign 0.01
R2986:Zfp384 UTSW 6 125,001,859 (GRCm39) missense possibly damaging 0.78
R4003:Zfp384 UTSW 6 125,010,200 (GRCm39) splice site probably benign
R4833:Zfp384 UTSW 6 125,007,811 (GRCm39) missense probably damaging 1.00
R4860:Zfp384 UTSW 6 125,007,893 (GRCm39) synonymous silent
R5084:Zfp384 UTSW 6 125,000,642 (GRCm39) splice site probably benign
R5137:Zfp384 UTSW 6 125,013,472 (GRCm39) unclassified probably benign
R5449:Zfp384 UTSW 6 125,001,101 (GRCm39) missense probably damaging 1.00
R5558:Zfp384 UTSW 6 125,013,472 (GRCm39) unclassified probably benign
R5720:Zfp384 UTSW 6 125,013,587 (GRCm39) missense probably benign 0.19
R5849:Zfp384 UTSW 6 125,001,062 (GRCm39) missense possibly damaging 0.91
R5961:Zfp384 UTSW 6 125,000,997 (GRCm39) missense probably damaging 1.00
R6165:Zfp384 UTSW 6 125,001,896 (GRCm39) splice site probably null
R6948:Zfp384 UTSW 6 125,001,873 (GRCm39) missense probably benign 0.08
R7106:Zfp384 UTSW 6 125,001,222 (GRCm39) missense probably benign 0.23
R7192:Zfp384 UTSW 6 125,010,275 (GRCm39) missense probably damaging 1.00
R7320:Zfp384 UTSW 6 125,001,793 (GRCm39) missense possibly damaging 0.92
R7730:Zfp384 UTSW 6 125,008,635 (GRCm39) missense probably benign 0.02
R7861:Zfp384 UTSW 6 125,013,288 (GRCm39) missense probably damaging 1.00
R8080:Zfp384 UTSW 6 125,013,521 (GRCm39) missense unknown
R9021:Zfp384 UTSW 6 125,013,336 (GRCm39) missense
R9568:Zfp384 UTSW 6 125,001,796 (GRCm39) missense possibly damaging 0.70
RF002:Zfp384 UTSW 6 125,013,434 (GRCm39) unclassified probably benign
RF003:Zfp384 UTSW 6 125,013,446 (GRCm39) unclassified probably benign
RF003:Zfp384 UTSW 6 125,013,439 (GRCm39) unclassified probably benign
RF003:Zfp384 UTSW 6 125,013,434 (GRCm39) unclassified probably benign
RF010:Zfp384 UTSW 6 125,013,451 (GRCm39) unclassified probably benign
RF010:Zfp384 UTSW 6 125,013,434 (GRCm39) unclassified probably benign
RF011:Zfp384 UTSW 6 125,013,439 (GRCm39) unclassified probably benign
RF014:Zfp384 UTSW 6 125,013,429 (GRCm39) unclassified probably benign
RF015:Zfp384 UTSW 6 125,013,444 (GRCm39) unclassified probably benign
RF018:Zfp384 UTSW 6 125,013,452 (GRCm39) unclassified probably benign
RF020:Zfp384 UTSW 6 125,013,451 (GRCm39) unclassified probably benign
RF020:Zfp384 UTSW 6 125,013,418 (GRCm39) unclassified probably benign
RF022:Zfp384 UTSW 6 125,013,434 (GRCm39) unclassified probably benign
RF024:Zfp384 UTSW 6 125,013,452 (GRCm39) unclassified probably benign
RF026:Zfp384 UTSW 6 125,013,455 (GRCm39) unclassified probably benign
RF027:Zfp384 UTSW 6 125,013,453 (GRCm39) unclassified probably benign
RF030:Zfp384 UTSW 6 125,013,446 (GRCm39) unclassified probably benign
RF056:Zfp384 UTSW 6 125,013,453 (GRCm39) unclassified probably benign
RF057:Zfp384 UTSW 6 125,013,459 (GRCm39) unclassified probably benign
RF062:Zfp384 UTSW 6 125,013,429 (GRCm39) unclassified probably benign
Predicted Primers PCR Primer
(F):5'- AGAAAGTTTCTAGAGCTTCCCCG -3'
(R):5'- TGCTGCAGATGTGAGAGCTG -3'

Sequencing Primer
(F):5'- AAAGTTTCTAGAGCTTCCCCGTGTAG -3'
(R):5'- CTGGCGGAAGGATTTCTCACAG -3'
Posted On 2022-09-12