Incidental Mutation 'R9606:Olfr812'
ID 723881
Institutional Source Beutler Lab
Gene Symbol Olfr812
Ensembl Gene ENSMUSG00000049052
Gene Name olfactory receptor 812
Synonyms GA_x6K02T2PULF-11521598-11520666, MOR110-1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock # R9606 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 129841418-129846094 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 129842756 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Stop codon at position 95 (C95*)
Ref Sequence ENSEMBL: ENSMUSP00000145284 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057775] [ENSMUST00000203571] [ENSMUST00000205013]
AlphaFold Q8VG64
Predicted Effect probably null
Transcript: ENSMUST00000057775
AA Change: C95*
SMART Domains Protein: ENSMUSP00000053359
Gene: ENSMUSG00000049052
AA Change: C95*

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 2.3e-50 PFAM
Pfam:7tm_1 39 288 9.5e-25 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000203571
AA Change: C95*
SMART Domains Protein: ENSMUSP00000145284
Gene: ENSMUSG00000049052
AA Change: C95*

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 2.3e-50 PFAM
Pfam:7tm_1 39 288 9.5e-25 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000205013
AA Change: C95*
SMART Domains Protein: ENSMUSP00000145482
Gene: ENSMUSG00000049052
AA Change: C95*

DomainStartEndE-ValueType
Pfam:7tm_4 29 307 1.3e-44 PFAM
Pfam:7tm_1 39 288 4.1e-23 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430548M08Rik A G 8: 120,153,967 Y286C probably damaging Het
A530032D15Rik G C 1: 85,097,623 probably null Het
Cacna1c T C 6: 118,610,494 T1657A Het
Ccs A T 19: 4,832,869 D151E probably benign Het
Cfap74 A G 4: 155,424,676 T295A Het
Chmp4c A T 3: 10,367,162 E44V probably damaging Het
Crybg2 A T 4: 134,074,072 K539* probably null Het
Dgkg T C 16: 22,622,261 M1V probably null Het
E2f2 T A 4: 136,184,432 Y251* probably null Het
Fat2 T C 11: 55,289,267 Y1416C probably damaging Het
Fgl2 T C 5: 21,372,993 S93P possibly damaging Het
Hivep3 C T 4: 120,132,589 T2079I probably damaging Het
Igfl3 A C 7: 18,179,995 K90T possibly damaging Het
Lsamp A G 16: 41,888,929 D74G probably benign Het
Mmrn2 C A 14: 34,397,697 T211K possibly damaging Het
Mov10 A T 3: 104,800,348 V570D probably benign Het
Mrc1 A T 2: 14,308,706 Y916F probably benign Het
Myo10 CAGGTATAAAG CAG 15: 25,776,315 probably null Het
Ndc1 T A 4: 107,389,489 C370S probably damaging Het
Nln TGGTCCAGGTAAAACTGCCCCAGCCAATCAGGTACCTTGGATAGAGGTCCAGGTAAAACTGCCCCAGCCAATCAGGTACCTTGGATAGAGGTCCAGGTAGAACTGCCCCAGC TGGTCCAGGTAAAACTGCCCCAGCCAATCAGGTACCTTGGATAGAGGTCCAGGTAGAACTGCCCCAGC 13: 104,050,416 probably null Het
Nrcam A T 12: 44,562,457 N455I probably damaging Het
Nrp1 G A 8: 128,502,548 E836K probably benign Het
Olfr1477 A T 19: 13,502,579 K79* probably null Het
Olfr329-ps C T 11: 58,542,927 C196Y probably damaging Het
Olfr915 A G 9: 38,647,324 S67P probably damaging Het
Pcca T C 14: 122,664,305 S287P probably damaging Het
Pitpnm3 T A 11: 72,064,243 T482S probably benign Het
Pld2 C T 11: 70,555,067 R676* probably null Het
Ppm1k T C 6: 57,514,072 Y286C possibly damaging Het
Rb1 T C 14: 73,280,133 N278D probably damaging Het
Sema3g T C 14: 31,221,826 L221P probably damaging Het
Skint2 C T 4: 112,625,950 T184I probably benign Het
Slc38a2 A G 15: 96,693,291 F232S probably damaging Het
Snx6 T C 12: 54,768,026 N170S probably benign Het
Sox9 T A 11: 112,782,590 N2K probably damaging Het
Srpk2 T C 5: 23,524,606 E345G probably benign Het
Tbc1d21 T C 9: 58,361,204 M291V possibly damaging Het
Tekt2 T C 4: 126,324,900 N20S probably benign Het
Tnxb T G 17: 34,695,604 I1888S possibly damaging Het
Tsnaxip1 G A 8: 105,840,053 E174K probably damaging Het
Ttc28 G A 5: 111,285,274 R2058Q probably benign Het
Ttn C T 2: 76,885,013 E7912K unknown Het
Ttyh2 T A 11: 114,710,841 D430E probably benign Het
Ubr2 C T 17: 46,934,094 G1669R probably damaging Het
Vcan A T 13: 89,705,372 S490T probably damaging Het
Vmn1r86 T A 7: 13,102,814 D45V probably damaging Het
Wdr12 A G 1: 60,088,067 V143A possibly damaging Het
Zbtb18 T A 1: 177,447,423 Y116* probably null Het
Zdbf2 C T 1: 63,303,377 T305I possibly damaging Het
Zfp384 T A 6: 125,030,839 M244K possibly damaging Het
Zfp423 A T 8: 87,687,967 V1241D probably damaging Het
Zfp574 A G 7: 25,081,215 Y554C probably damaging Het
Zfp616 T C 11: 74,085,394 S830P probably damaging Het
Zfp839 A G 12: 110,868,342 Y677C probably benign Het
Other mutations in Olfr812
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Olfr812 APN 10 129842473 missense probably damaging 1.00
IGL01637:Olfr812 APN 10 129842610 missense probably benign 0.14
IGL02035:Olfr812 APN 10 129842790 missense possibly damaging 0.95
IGL02546:Olfr812 APN 10 129842547 missense probably damaging 0.97
R1902:Olfr812 UTSW 10 129842506 missense probably benign
R4583:Olfr812 UTSW 10 129842475 missense probably damaging 1.00
R4598:Olfr812 UTSW 10 129842995 missense possibly damaging 0.92
R4714:Olfr812 UTSW 10 129842945 missense probably damaging 0.99
R5196:Olfr812 UTSW 10 129842781 missense possibly damaging 0.90
R5953:Olfr812 UTSW 10 129842614 missense probably benign 0.22
R6311:Olfr812 UTSW 10 129842907 missense possibly damaging 0.88
R6356:Olfr812 UTSW 10 129842608 missense probably benign 0.14
R6499:Olfr812 UTSW 10 129842584 missense probably benign 0.00
R9149:Olfr812 UTSW 10 129842613 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AAATCCAGTTTGAGCCCCAAG -3'
(R):5'- ACATTTTGAGCATGATGGGGAAC -3'

Sequencing Primer
(F):5'- TTTGAGCCCCAAGAGCAAAG -3'
(R):5'- GATGGGGAACTTAACGATCATCCTC -3'
Posted On 2022-09-12