Mutagenetix > Incidental Mutation

Incidental Mutation 'R9606:Myo10'

723898

Institutional Source

Beutler Lab

Gene Symbol

Myo10

Ensembl Gene

ENSMUSG00000022272

Gene Name

myosin X

Synonyms

D15Ertd600e, myosin-X

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9606 (G1)

Quality Score

217.468

Status

Not validated

Chromosome

Chromosomal Location

25622525-25813673 bp(+) (GRCm38)

Type of Mutation

frame shift

DNA Base Change (assembly)

CAGGTATAAAG to CAG at 25776315 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000106087 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022882] [ENSMUST00000110457] [ENSMUST00000124966] [ENSMUST00000125667] [ENSMUST00000131834] [ENSMUST00000135173] [ENSMUST00000137601] [ENSMUST00000151360]

AlphaFold

F8VQB6

Predicted Effect

probably benign
Transcript: ENSMUST00000022882

SMART Domains

Protein: ENSMUSP00000022882
Gene: ENSMUSG00000022272

Domain	Start	End	E-Value	Type
IQ	1	17	7.83e1	SMART
IQ	18	40	1.06e0	SMART
IQ	41	63	7.07e-2	SMART
PDB:2LW9\|B	136	171	7e-13	PDB
low complexity region	172	186	N/A	INTRINSIC
low complexity region	213	235	N/A	INTRINSIC
low complexity region	344	356	N/A	INTRINSIC
low complexity region	401	419	N/A	INTRINSIC
PH	471	570	1.39e-21	SMART
SCOP:d1faoa_	588	639	3e-6	SMART
PH	651	757	6.76e-11	SMART
MyTH4	805	953	4.12e-37	SMART
B41	954	1216	1.72e-44	SMART
Blast:B41	1218	1303	3e-45	BLAST
low complexity region	1304	1316	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000110457

SMART Domains

Protein: ENSMUSP00000106087
Gene: ENSMUSG00000022272

Domain	Start	End	E-Value	Type
MYSc	57	740	N/A	SMART
IQ	741	763	1.27e-3	SMART
IQ	764	786	1.06e0	SMART
IQ	787	809	7.07e-2	SMART
Pfam:MYO10_CC	881	932	4.2e-22	PFAM
low complexity region	959	981	N/A	INTRINSIC
low complexity region	1090	1102	N/A	INTRINSIC
low complexity region	1147	1165	N/A	INTRINSIC
PH	1217	1316	1.39e-21	SMART
PH	1397	1503	6.76e-11	SMART
MyTH4	1551	1699	4.12e-37	SMART
B41	1700	1962	1.72e-44	SMART
low complexity region	2050	2062	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000124966

SMART Domains

Protein: ENSMUSP00000120817
Gene: ENSMUSG00000022272

Domain	Start	End	E-Value	Type
IQ	1	17	7.83e1	SMART
IQ	18	40	1.06e0	SMART
IQ	41	63	7.07e-2	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000125667

SMART Domains

Protein: ENSMUSP00000120566
Gene: ENSMUSG00000022272

Domain	Start	End	E-Value	Type
Pfam:Myosin_head	1	85	5.8e-22	PFAM
IQ	99	121	1.27e-3	SMART
IQ	122	144	1.06e0	SMART
IQ	145	167	7.07e-2	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000131834

Predicted Effect

probably null
Transcript: ENSMUST00000135173

SMART Domains

Protein: ENSMUSP00000118744
Gene: ENSMUSG00000022272

Domain	Start	End	E-Value	Type
Pfam:Myosin_head	1	84	1.4e-21	PFAM
IQ	98	120	1.27e-3	SMART
IQ	121	143	1.06e0	SMART
IQ	144	166	7.07e-2	SMART
low complexity region	168	179	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000135981

SMART Domains

Protein: ENSMUSP00000123057
Gene: ENSMUSG00000022272

Domain	Start	End	E-Value	Type
PDB:2DFS\|M	2	38	6e-7	PDB
Blast:MYSc	2	42	3e-19	BLAST
IQ	59	81	1.27e-3	SMART
IQ	82	104	1.06e0	SMART
IQ	105	127	7.07e-2	SMART
Pfam:MYO10_CC	199	242	1.7e-20	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000137601

SMART Domains

Protein: ENSMUSP00000118280
Gene: ENSMUSG00000022272

Domain	Start	End	E-Value	Type
MYSc	24	707	N/A	SMART
IQ	708	730	1.27e-3	SMART
IQ	731	753	1.06e0	SMART
IQ	754	776	7.07e-2	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000151360

SMART Domains

Protein: ENSMUSP00000119367
Gene: ENSMUSG00000022272

Domain	Start	End	E-Value	Type
Pfam:Myosin_head	1	51	7.1e-16	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the myosin superfamily. The protein represents an unconventional myosin; it should not be confused with the conventional non-muscle myosin-10 (MYH10). Unconventional myosins contain the basic domains of conventional myosins and are further distinguished from class members by their tail domains. This gene functions as an actin-based molecular motor and plays a role in integration of F-actin and microtubule cytoskeletons during meiosis. [provided by RefSeq, Dec 2011]
PHENOTYPE: Homozygous null mutations are semi-lethal with over half of homozygous embryos exhibiting exencephaly. Surviving mutants show decreased body weight, white spotting, syndactyly, persistence of hyaloid vascular system and other eye defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
6430548M08Rik	A	G	8: 120,153,967	Y286C	probably damaging	Het
A530032D15Rik	G	C	1: 85,097,623		probably null	Het
Cacna1c	T	C	6: 118,610,494	T1657A		Het
Ccs	A	T	19: 4,832,869	D151E	probably benign	Het
Cfap74	A	G	4: 155,424,676	T295A		Het
Chmp4c	A	T	3: 10,367,162	E44V	probably damaging	Het
Crybg2	A	T	4: 134,074,072	K539*	probably null	Het
Dgkg	T	C	16: 22,622,261	M1V	probably null	Het
E2f2	T	A	4: 136,184,432	Y251*	probably null	Het
Fat2	T	C	11: 55,289,267	Y1416C	probably damaging	Het
Fgl2	T	C	5: 21,372,993	S93P	possibly damaging	Het
Hivep3	C	T	4: 120,132,589	T2079I	probably damaging	Het
Igfl3	A	C	7: 18,179,995	K90T	possibly damaging	Het
Lsamp	A	G	16: 41,888,929	D74G	probably benign	Het
Mmrn2	C	A	14: 34,397,697	T211K	possibly damaging	Het
Mov10	A	T	3: 104,800,348	V570D	probably benign	Het
Mrc1	A	T	2: 14,308,706	Y916F	probably benign	Het
Ndc1	T	A	4: 107,389,489	C370S	probably damaging	Het
Nln	TGGTCCAGGTAAAACTGCCCCAGCCAATCAGGTACCTTGGATAGAGGTCCAGGTAAAACTGCCCCAGCCAATCAGGTACCTTGGATAGAGGTCCAGGTAGAACTGCCCCAGC	TGGTCCAGGTAAAACTGCCCCAGCCAATCAGGTACCTTGGATAGAGGTCCAGGTAGAACTGCCCCAGC	13: 104,050,416		probably null	Het
Nrcam	A	T	12: 44,562,457	N455I	probably damaging	Het
Nrp1	G	A	8: 128,502,548	E836K	probably benign	Het
Olfr1477	A	T	19: 13,502,579	K79*	probably null	Het
Olfr329-ps	C	T	11: 58,542,927	C196Y	probably damaging	Het
Olfr812	A	T	10: 129,842,756	C95*	probably null	Het
Olfr915	A	G	9: 38,647,324	S67P	probably damaging	Het
Pcca	T	C	14: 122,664,305	S287P	probably damaging	Het
Pitpnm3	T	A	11: 72,064,243	T482S	probably benign	Het
Pld2	C	T	11: 70,555,067	R676*	probably null	Het
Ppm1k	T	C	6: 57,514,072	Y286C	possibly damaging	Het
Rb1	T	C	14: 73,280,133	N278D	probably damaging	Het
Sema3g	T	C	14: 31,221,826	L221P	probably damaging	Het
Skint2	C	T	4: 112,625,950	T184I	probably benign	Het
Slc38a2	A	G	15: 96,693,291	F232S	probably damaging	Het
Snx6	T	C	12: 54,768,026	N170S	probably benign	Het
Sox9	T	A	11: 112,782,590	N2K	probably damaging	Het
Srpk2	T	C	5: 23,524,606	E345G	probably benign	Het
Tbc1d21	T	C	9: 58,361,204	M291V	possibly damaging	Het
Tekt2	T	C	4: 126,324,900	N20S	probably benign	Het
Tnxb	T	G	17: 34,695,604	I1888S	possibly damaging	Het
Tsnaxip1	G	A	8: 105,840,053	E174K	probably damaging	Het
Ttc28	G	A	5: 111,285,274	R2058Q	probably benign	Het
Ttn	C	T	2: 76,885,013	E7912K	unknown	Het
Ttyh2	T	A	11: 114,710,841	D430E	probably benign	Het
Ubr2	C	T	17: 46,934,094	G1669R	probably damaging	Het
Vcan	A	T	13: 89,705,372	S490T	probably damaging	Het
Vmn1r86	T	A	7: 13,102,814	D45V	probably damaging	Het
Wdr12	A	G	1: 60,088,067	V143A	possibly damaging	Het
Zbtb18	T	A	1: 177,447,423	Y116*	probably null	Het
Zdbf2	C	T	1: 63,303,377	T305I	possibly damaging	Het
Zfp384	T	A	6: 125,030,839	M244K	possibly damaging	Het
Zfp423	A	T	8: 87,687,967	V1241D	probably damaging	Het
Zfp574	A	G	7: 25,081,215	Y554C	probably damaging	Het
Zfp616	T	C	11: 74,085,394	S830P	probably damaging	Het
Zfp839	A	G	12: 110,868,342	Y677C	probably benign	Het

Other mutations in Myo10

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00557:Myo10	APN	15	25776380	missense	probably damaging	1.00
IGL01068:Myo10	APN	15	25739309	missense	possibly damaging	0.93
IGL01352:Myo10	APN	15	25701697	missense	probably damaging	1.00
IGL01388:Myo10	APN	15	25736617	missense	possibly damaging	0.55
IGL01460:Myo10	APN	15	25714108	missense	probably benign	0.00
IGL01553:Myo10	APN	15	25776329	missense	probably damaging	1.00
IGL01732:Myo10	APN	15	25732063	missense	probably benign	0.10
IGL01992:Myo10	APN	15	25799548	missense	possibly damaging	0.92
IGL02000:Myo10	APN	15	25808066	missense	probably damaging	1.00
IGL02045:Myo10	APN	15	25726488	missense	probably benign	0.03
IGL02307:Myo10	APN	15	25776315	splice site	probably benign
IGL02511:Myo10	APN	15	25723889	missense	probably damaging	0.97
IGL03240:Myo10	APN	15	25701602	missense	probably damaging	1.00
least	UTSW	15	25726475	nonsense	probably null
R0037:Myo10	UTSW	15	25666532	intron	probably benign
R0153:Myo10	UTSW	15	25781238	missense	possibly damaging	0.84
R0282:Myo10	UTSW	15	25793167	missense	probably damaging	1.00
R0360:Myo10	UTSW	15	25804368	missense	probably damaging	1.00
R0585:Myo10	UTSW	15	25736455	missense	probably damaging	1.00
R0617:Myo10	UTSW	15	25738005	missense	probably damaging	1.00
R0729:Myo10	UTSW	15	25722157	splice site	probably benign
R0771:Myo10	UTSW	15	25778178	missense	probably damaging	1.00
R0960:Myo10	UTSW	15	25801189	missense	probably damaging	1.00
R1562:Myo10	UTSW	15	25780411	missense	possibly damaging	0.81
R1651:Myo10	UTSW	15	25742369	missense	probably damaging	1.00
R1789:Myo10	UTSW	15	25726525	critical splice donor site	probably null
R1816:Myo10	UTSW	15	25800200	missense	probably damaging	1.00
R1835:Myo10	UTSW	15	25805587	missense	possibly damaging	0.53
R1908:Myo10	UTSW	15	25801222	missense	probably damaging	1.00
R2082:Myo10	UTSW	15	25785993	missense	probably damaging	1.00
R2101:Myo10	UTSW	15	25722259	missense	probably benign	0.26
R2129:Myo10	UTSW	15	25781799	missense	probably benign	0.09
R2141:Myo10	UTSW	15	25714108	missense	probably benign
R2142:Myo10	UTSW	15	25714108	missense	probably benign
R2920:Myo10	UTSW	15	25801140	missense	probably damaging	1.00
R2938:Myo10	UTSW	15	25795717	missense	probably damaging	0.99
R3723:Myo10	UTSW	15	25803288	missense	probably damaging	1.00
R3852:Myo10	UTSW	15	25779626	missense	probably damaging	1.00
R4162:Myo10	UTSW	15	25726415	splice site	probably null
R4163:Myo10	UTSW	15	25726415	splice site	probably null
R4164:Myo10	UTSW	15	25726415	splice site	probably null
R4177:Myo10	UTSW	15	25734051	missense	possibly damaging	0.81
R4409:Myo10	UTSW	15	25807869	missense	probably damaging	1.00
R4667:Myo10	UTSW	15	25793153	missense	possibly damaging	0.91
R4905:Myo10	UTSW	15	25800212	missense	probably damaging	0.99
R4933:Myo10	UTSW	15	25781118	missense	probably damaging	0.96
R4968:Myo10	UTSW	15	25808184	missense	probably damaging	1.00
R5081:Myo10	UTSW	15	25785940	missense	probably damaging	1.00
R5123:Myo10	UTSW	15	25726483	missense	possibly damaging	0.94
R5310:Myo10	UTSW	15	25778078	splice site	probably null
R6073:Myo10	UTSW	15	25736642	missense	probably damaging	1.00
R6117:Myo10	UTSW	15	25805659	missense	probably benign	0.00
R6185:Myo10	UTSW	15	25726510	missense	probably damaging	0.99
R6749:Myo10	UTSW	15	25714110	missense	probably damaging	1.00
R6819:Myo10	UTSW	15	25781410	missense	possibly damaging	0.80
R6875:Myo10	UTSW	15	25805659	missense	probably benign	0.00
R6908:Myo10	UTSW	15	25804383	missense	probably damaging	1.00
R6963:Myo10	UTSW	15	25734063	missense	probably benign	0.31
R7144:Myo10	UTSW	15	25723925	missense	probably damaging	1.00
R7266:Myo10	UTSW	15	25782981	missense	probably damaging	1.00
R7380:Myo10	UTSW	15	25779620	missense	probably benign	0.01
R7460:Myo10	UTSW	15	25807827	missense	probably damaging	1.00
R7614:Myo10	UTSW	15	25701623	missense	probably benign	0.00
R7618:Myo10	UTSW	15	25726475	nonsense	probably null
R7717:Myo10	UTSW	15	25731970	missense	probably benign	0.01
R7811:Myo10	UTSW	15	25804524	missense	probably damaging	1.00
R7830:Myo10	UTSW	15	25737971	nonsense	probably null
R7862:Myo10	UTSW	15	25666436	missense	probably damaging	1.00
R8232:Myo10	UTSW	15	25804314	missense	possibly damaging	0.89
R8264:Myo10	UTSW	15	25800109	missense	probably damaging	0.99
R8377:Myo10	UTSW	15	25804395	missense	possibly damaging	0.94
R8385:Myo10	UTSW	15	25804398	missense	probably damaging	1.00
R8426:Myo10	UTSW	15	25799490	missense	probably damaging	0.99
R8439:Myo10	UTSW	15	25725072	missense	probably benign	0.00
R8696:Myo10	UTSW	15	25799486	missense	probably damaging	1.00
R8775:Myo10	UTSW	15	25800059	missense	probably damaging	0.97
R8775-TAIL:Myo10	UTSW	15	25800059	missense	probably damaging	0.97
R8970:Myo10	UTSW	15	25803381	missense	possibly damaging	0.82
R9024:Myo10	UTSW	15	25793209	missense	possibly damaging	0.53
R9196:Myo10	UTSW	15	25805630	missense	probably damaging	0.96
R9224:Myo10	UTSW	15	25807995	missense	probably benign	0.33
R9308:Myo10	UTSW	15	25781776	missense	probably damaging	0.99
R9358:Myo10	UTSW	15	25781434	missense	possibly damaging	0.69
R9722:Myo10	UTSW	15	25801141	missense	probably damaging	1.00
RF013:Myo10	UTSW	15	25799479	missense	probably damaging	0.99
Z1177:Myo10	UTSW	15	25781401	missense	probably damaging	1.00
Z1177:Myo10	UTSW	15	25799554	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- AGAAGACCCTTTCAGGACTTTTAC -3'
(R):5'- CTTAGCCGCATTTGGGAACG -3'

Sequencing Primer
(F):5'- GACCCTTTCAGGACTTTTACAAAAGG -3'
(R):5'- AACGGTACAGCCTTGGGTATC -3'

Posted On

2022-09-12