Incidental Mutation 'R9606:Ubr2'
ID 723903
Institutional Source Beutler Lab
Gene Symbol Ubr2
Ensembl Gene ENSMUSG00000023977
Gene Name ubiquitin protein ligase E3 component n-recognin 2
Synonyms 9930021A08Rik, E130209G04Rik, ENSMUSG00000043296
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.913) question?
Stock # R9606 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 46928295-47010556 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 46934094 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Arginine at position 1669 (G1669R)
Ref Sequence ENSEMBL: ENSMUSP00000108961 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113335] [ENSMUST00000113337]
AlphaFold Q6WKZ8
Predicted Effect probably damaging
Transcript: ENSMUST00000113335
AA Change: G1669R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108961
Gene: ENSMUSG00000023977
AA Change: G1669R

DomainStartEndE-ValueType
ZnF_UBR1 97 167 3.14e-32 SMART
Pfam:ClpS 221 302 2.4e-23 PFAM
low complexity region 635 646 N/A INTRINSIC
low complexity region 749 760 N/A INTRINSIC
low complexity region 872 886 N/A INTRINSIC
coiled coil region 1019 1046 N/A INTRINSIC
RING 1108 1213 7.66e-1 SMART
low complexity region 1221 1235 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113337
AA Change: G1669R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108963
Gene: ENSMUSG00000023977
AA Change: G1669R

DomainStartEndE-ValueType
ZnF_UBR1 97 167 3.14e-32 SMART
Pfam:ClpS 222 301 6.2e-26 PFAM
low complexity region 635 646 N/A INTRINSIC
low complexity region 749 760 N/A INTRINSIC
low complexity region 872 886 N/A INTRINSIC
coiled coil region 1019 1046 N/A INTRINSIC
RING 1108 1213 7.66e-1 SMART
low complexity region 1221 1235 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an E3 ubiquitin ligase of the N-end rule proteolytic pathway that targets proteins with destabilizing N-terminal residues for polyubiquitylation and proteasome-mediated degradation. Alternative splicing results in multiple transcript variants.[provided by RefSeq, May 2010]
PHENOTYPE: On a mixed genetic background, female homozygotes for a targeted null mutation exhibit embryonic lethality, while males are viable, but sterile due to postnatal testicular degeneration. On an inbred background, both genders die in utero. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430548M08Rik A G 8: 120,153,967 Y286C probably damaging Het
A530032D15Rik G C 1: 85,097,623 probably null Het
Cacna1c T C 6: 118,610,494 T1657A Het
Ccs A T 19: 4,832,869 D151E probably benign Het
Cfap74 A G 4: 155,424,676 T295A Het
Chmp4c A T 3: 10,367,162 E44V probably damaging Het
Crybg2 A T 4: 134,074,072 K539* probably null Het
Dgkg T C 16: 22,622,261 M1V probably null Het
E2f2 T A 4: 136,184,432 Y251* probably null Het
Fat2 T C 11: 55,289,267 Y1416C probably damaging Het
Fgl2 T C 5: 21,372,993 S93P possibly damaging Het
Hivep3 C T 4: 120,132,589 T2079I probably damaging Het
Igfl3 A C 7: 18,179,995 K90T possibly damaging Het
Lsamp A G 16: 41,888,929 D74G probably benign Het
Mmrn2 C A 14: 34,397,697 T211K possibly damaging Het
Mov10 A T 3: 104,800,348 V570D probably benign Het
Mrc1 A T 2: 14,308,706 Y916F probably benign Het
Myo10 CAGGTATAAAG CAG 15: 25,776,315 probably null Het
Ndc1 T A 4: 107,389,489 C370S probably damaging Het
Nln TGGTCCAGGTAAAACTGCCCCAGCCAATCAGGTACCTTGGATAGAGGTCCAGGTAAAACTGCCCCAGCCAATCAGGTACCTTGGATAGAGGTCCAGGTAGAACTGCCCCAGC TGGTCCAGGTAAAACTGCCCCAGCCAATCAGGTACCTTGGATAGAGGTCCAGGTAGAACTGCCCCAGC 13: 104,050,416 probably null Het
Nrcam A T 12: 44,562,457 N455I probably damaging Het
Nrp1 G A 8: 128,502,548 E836K probably benign Het
Olfr1477 A T 19: 13,502,579 K79* probably null Het
Olfr329-ps C T 11: 58,542,927 C196Y probably damaging Het
Olfr812 A T 10: 129,842,756 C95* probably null Het
Olfr915 A G 9: 38,647,324 S67P probably damaging Het
Pcca T C 14: 122,664,305 S287P probably damaging Het
Pitpnm3 T A 11: 72,064,243 T482S probably benign Het
Pld2 C T 11: 70,555,067 R676* probably null Het
Ppm1k T C 6: 57,514,072 Y286C possibly damaging Het
Rb1 T C 14: 73,280,133 N278D probably damaging Het
Sema3g T C 14: 31,221,826 L221P probably damaging Het
Skint2 C T 4: 112,625,950 T184I probably benign Het
Slc38a2 A G 15: 96,693,291 F232S probably damaging Het
Snx6 T C 12: 54,768,026 N170S probably benign Het
Sox9 T A 11: 112,782,590 N2K probably damaging Het
Srpk2 T C 5: 23,524,606 E345G probably benign Het
Tbc1d21 T C 9: 58,361,204 M291V possibly damaging Het
Tekt2 T C 4: 126,324,900 N20S probably benign Het
Tnxb T G 17: 34,695,604 I1888S possibly damaging Het
Tsnaxip1 G A 8: 105,840,053 E174K probably damaging Het
Ttc28 G A 5: 111,285,274 R2058Q probably benign Het
Ttn C T 2: 76,885,013 E7912K unknown Het
Ttyh2 T A 11: 114,710,841 D430E probably benign Het
Vcan A T 13: 89,705,372 S490T probably damaging Het
Vmn1r86 T A 7: 13,102,814 D45V probably damaging Het
Wdr12 A G 1: 60,088,067 V143A possibly damaging Het
Zbtb18 T A 1: 177,447,423 Y116* probably null Het
Zdbf2 C T 1: 63,303,377 T305I possibly damaging Het
Zfp384 T A 6: 125,030,839 M244K possibly damaging Het
Zfp423 A T 8: 87,687,967 V1241D probably damaging Het
Zfp574 A G 7: 25,081,215 Y554C probably damaging Het
Zfp616 T C 11: 74,085,394 S830P probably damaging Het
Zfp839 A G 12: 110,868,342 Y677C probably benign Het
Other mutations in Ubr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Ubr2 APN 17 46986060 splice site probably benign
IGL00332:Ubr2 APN 17 46990990 critical splice donor site probably null
IGL00518:Ubr2 APN 17 46992996 missense probably damaging 1.00
IGL00693:Ubr2 APN 17 46972981 missense probably benign 0.01
IGL00785:Ubr2 APN 17 46944865 missense possibly damaging 0.69
IGL01144:Ubr2 APN 17 46957321 missense probably damaging 1.00
IGL01459:Ubr2 APN 17 46930509 splice site probably benign
IGL01637:Ubr2 APN 17 46956654 missense probably damaging 1.00
IGL01710:Ubr2 APN 17 46943409 missense probably benign 0.00
IGL01726:Ubr2 APN 17 46992981 splice site probably benign
IGL01925:Ubr2 APN 17 46954949 missense possibly damaging 0.92
IGL01960:Ubr2 APN 17 46973967 missense probably benign 0.45
IGL02170:Ubr2 APN 17 46967197 missense probably benign 0.05
IGL02308:Ubr2 APN 17 46934193 missense probably damaging 1.00
IGL02387:Ubr2 APN 17 46963150 missense probably benign
IGL02696:Ubr2 APN 17 46963765 missense probably benign
IGL02726:Ubr2 APN 17 46972921 missense probably damaging 1.00
IGL02750:Ubr2 APN 17 46969282 missense probably benign 0.00
IGL02934:Ubr2 APN 17 46957340 missense possibly damaging 0.50
IGL02959:Ubr2 APN 17 46975951 missense probably damaging 0.96
IGL03018:Ubr2 APN 17 46954046 missense possibly damaging 0.64
IGL03343:Ubr2 APN 17 46951918 missense probably benign 0.00
PIT4280001:Ubr2 UTSW 17 46944863 missense probably damaging 1.00
R0044:Ubr2 UTSW 17 46992985 splice site probably benign
R0044:Ubr2 UTSW 17 46992985 splice site probably benign
R0446:Ubr2 UTSW 17 46983298 missense probably damaging 1.00
R0513:Ubr2 UTSW 17 46986779 nonsense probably null
R0565:Ubr2 UTSW 17 46955886 missense probably damaging 1.00
R0600:Ubr2 UTSW 17 46967248 missense probably damaging 0.99
R0690:Ubr2 UTSW 17 46938653 missense probably damaging 0.97
R0710:Ubr2 UTSW 17 46938681 missense probably damaging 0.96
R0761:Ubr2 UTSW 17 46983316 missense probably damaging 1.00
R0798:Ubr2 UTSW 17 46969176 splice site probably benign
R0862:Ubr2 UTSW 17 46967083 nonsense probably null
R0947:Ubr2 UTSW 17 46941112 missense probably damaging 0.99
R0972:Ubr2 UTSW 17 46934261 splice site probably null
R1500:Ubr2 UTSW 17 46986689 missense possibly damaging 0.79
R1514:Ubr2 UTSW 17 47000823 missense probably damaging 1.00
R1533:Ubr2 UTSW 17 46967247 nonsense probably null
R1554:Ubr2 UTSW 17 46972951 missense probably benign
R1575:Ubr2 UTSW 17 46932492 missense probably damaging 1.00
R1602:Ubr2 UTSW 17 46941061 missense probably benign 0.30
R1941:Ubr2 UTSW 17 46974026 missense probably damaging 1.00
R1966:Ubr2 UTSW 17 46954919 missense probably benign 0.05
R2041:Ubr2 UTSW 17 46986047 missense probably damaging 1.00
R2067:Ubr2 UTSW 17 46963145 critical splice donor site probably null
R2111:Ubr2 UTSW 17 46963145 critical splice donor site probably null
R2189:Ubr2 UTSW 17 46943364 missense probably benign 0.01
R2219:Ubr2 UTSW 17 46986042 missense possibly damaging 0.94
R2307:Ubr2 UTSW 17 46966215 nonsense probably null
R3426:Ubr2 UTSW 17 46968439 missense probably damaging 1.00
R3428:Ubr2 UTSW 17 46968439 missense probably damaging 1.00
R3608:Ubr2 UTSW 17 46944523 missense probably damaging 1.00
R4080:Ubr2 UTSW 17 46988722 missense probably benign 0.05
R4330:Ubr2 UTSW 17 46967278 missense probably null 1.00
R4383:Ubr2 UTSW 17 46939387 missense probably benign 0.01
R4460:Ubr2 UTSW 17 46945045 critical splice donor site probably null
R4794:Ubr2 UTSW 17 46930445 missense probably damaging 1.00
R4902:Ubr2 UTSW 17 46985996 missense possibly damaging 0.91
R4913:Ubr2 UTSW 17 46959459 splice site probably null
R5092:Ubr2 UTSW 17 46969247 missense probably damaging 1.00
R5209:Ubr2 UTSW 17 46968424 missense probably damaging 1.00
R5226:Ubr2 UTSW 17 46983270 missense probably benign 0.04
R5250:Ubr2 UTSW 17 46930442 missense probably benign 0.01
R5437:Ubr2 UTSW 17 46963697 missense probably benign 0.00
R5607:Ubr2 UTSW 17 46934200 nonsense probably null
R5848:Ubr2 UTSW 17 46956655 missense possibly damaging 0.84
R6089:Ubr2 UTSW 17 46982292 missense possibly damaging 0.95
R6382:Ubr2 UTSW 17 46957315 missense possibly damaging 0.56
R6552:Ubr2 UTSW 17 46966268 splice site probably null
R6630:Ubr2 UTSW 17 46951984 missense possibly damaging 0.51
R6892:Ubr2 UTSW 17 46934108 missense probably damaging 0.99
R6936:Ubr2 UTSW 17 46973031 missense possibly damaging 0.94
R7039:Ubr2 UTSW 17 47010213 missense probably benign 0.01
R7050:Ubr2 UTSW 17 46961602 missense probably benign 0.30
R7078:Ubr2 UTSW 17 46955853 missense possibly damaging 0.59
R7126:Ubr2 UTSW 17 46974056 splice site probably null
R7219:Ubr2 UTSW 17 46935434 nonsense probably null
R7262:Ubr2 UTSW 17 47000739 missense probably damaging 0.97
R7352:Ubr2 UTSW 17 46930426 missense probably benign 0.19
R7366:Ubr2 UTSW 17 46955845 missense probably damaging 0.99
R7449:Ubr2 UTSW 17 46964788 missense probably damaging 1.00
R7496:Ubr2 UTSW 17 46990991 critical splice donor site probably null
R7759:Ubr2 UTSW 17 46986048 missense probably damaging 1.00
R7869:Ubr2 UTSW 17 46991008 missense probably benign 0.00
R7916:Ubr2 UTSW 17 46968382 critical splice donor site probably null
R8236:Ubr2 UTSW 17 46951909 missense probably benign
R8376:Ubr2 UTSW 17 46942795 missense probably benign 0.07
R9026:Ubr2 UTSW 17 46934115 missense probably damaging 1.00
R9216:Ubr2 UTSW 17 46981359 missense probably benign 0.36
R9339:Ubr2 UTSW 17 46973939 missense probably benign 0.30
R9558:Ubr2 UTSW 17 46951917 missense probably benign
R9644:Ubr2 UTSW 17 46955780 critical splice donor site probably null
R9731:Ubr2 UTSW 17 46963145 critical splice donor site probably null
X0027:Ubr2 UTSW 17 47000629 missense probably damaging 0.99
X0061:Ubr2 UTSW 17 46970111 missense possibly damaging 0.88
Z1177:Ubr2 UTSW 17 46959509 missense probably benign
Z1177:Ubr2 UTSW 17 47000766 missense possibly damaging 0.76
Z1177:Ubr2 UTSW 17 47010143 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- ATCGCCCCACATTTAAGGAGG -3'
(R):5'- CAGATTATTTTCCAGGGTGCTCTG -3'

Sequencing Primer
(F):5'- CCCACATTTAAGGAGGCACAAAGG -3'
(R):5'- GTGCCTGTTCCTTTGTAACAG -3'
Posted On 2022-09-12