Incidental Mutation 'R9606:Ubr2'
ID 723903
Institutional Source Beutler Lab
Gene Symbol Ubr2
Ensembl Gene ENSMUSG00000023977
Gene Name ubiquitin protein ligase E3 component n-recognin 2
Synonyms ENSMUSG00000043296, E130209G04Rik, 9930021A08Rik
MMRRC Submission
Accession Numbers
Essential gene? Probably essential (E-score: 0.891) question?
Stock # R9606 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 47239221-47321482 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 47245020 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Arginine at position 1669 (G1669R)
Ref Sequence ENSEMBL: ENSMUSP00000108961 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113335] [ENSMUST00000113337]
AlphaFold Q6WKZ8
Predicted Effect probably damaging
Transcript: ENSMUST00000113335
AA Change: G1669R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108961
Gene: ENSMUSG00000023977
AA Change: G1669R

DomainStartEndE-ValueType
ZnF_UBR1 97 167 3.14e-32 SMART
Pfam:ClpS 221 302 2.4e-23 PFAM
low complexity region 635 646 N/A INTRINSIC
low complexity region 749 760 N/A INTRINSIC
low complexity region 872 886 N/A INTRINSIC
coiled coil region 1019 1046 N/A INTRINSIC
RING 1108 1213 7.66e-1 SMART
low complexity region 1221 1235 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113337
AA Change: G1669R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108963
Gene: ENSMUSG00000023977
AA Change: G1669R

DomainStartEndE-ValueType
ZnF_UBR1 97 167 3.14e-32 SMART
Pfam:ClpS 222 301 6.2e-26 PFAM
low complexity region 635 646 N/A INTRINSIC
low complexity region 749 760 N/A INTRINSIC
low complexity region 872 886 N/A INTRINSIC
coiled coil region 1019 1046 N/A INTRINSIC
RING 1108 1213 7.66e-1 SMART
low complexity region 1221 1235 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an E3 ubiquitin ligase of the N-end rule proteolytic pathway that targets proteins with destabilizing N-terminal residues for polyubiquitylation and proteasome-mediated degradation. Alternative splicing results in multiple transcript variants.[provided by RefSeq, May 2010]
PHENOTYPE: On a mixed genetic background, female homozygotes for a targeted null mutation exhibit embryonic lethality, while males are viable, but sterile due to postnatal testicular degeneration. On an inbred background, both genders die in utero. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430548M08Rik A G 8: 120,880,706 (GRCm39) Y286C probably damaging Het
Cacna1c T C 6: 118,587,455 (GRCm39) T1657A Het
Ccs A T 19: 4,882,897 (GRCm39) D151E probably benign Het
Cfap74 A G 4: 155,509,133 (GRCm39) T295A Het
Chmp4c A T 3: 10,432,222 (GRCm39) E44V probably damaging Het
Crybg2 A T 4: 133,801,383 (GRCm39) K539* probably null Het
Dgkg T C 16: 22,441,011 (GRCm39) M1V probably null Het
E2f2 T A 4: 135,911,743 (GRCm39) Y251* probably null Het
Fat2 T C 11: 55,180,093 (GRCm39) Y1416C probably damaging Het
Fgl2 T C 5: 21,577,991 (GRCm39) S93P possibly damaging Het
Hivep3 C T 4: 119,989,786 (GRCm39) T2079I probably damaging Het
Igfl3 A C 7: 17,913,920 (GRCm39) K90T possibly damaging Het
Lsamp A G 16: 41,709,292 (GRCm39) D74G probably benign Het
Mmrn2 C A 14: 34,119,654 (GRCm39) T211K possibly damaging Het
Mov10 A T 3: 104,707,664 (GRCm39) V570D probably benign Het
Mrc1 A T 2: 14,313,517 (GRCm39) Y916F probably benign Het
Myo10 CAGGTATAAAG CAG 15: 25,776,401 (GRCm39) probably null Het
Ndc1 T A 4: 107,246,686 (GRCm39) C370S probably damaging Het
Nln TGGTCCAGGTAAAACTGCCCCAGCCAATCAGGTACCTTGGATAGAGGTCCAGGTAAAACTGCCCCAGCCAATCAGGTACCTTGGATAGAGGTCCAGGTAGAACTGCCCCAGC TGGTCCAGGTAAAACTGCCCCAGCCAATCAGGTACCTTGGATAGAGGTCCAGGTAGAACTGCCCCAGC 13: 104,186,924 (GRCm39) probably null Het
Nrcam A T 12: 44,609,240 (GRCm39) N455I probably damaging Het
Nrp1 G A 8: 129,229,029 (GRCm39) E836K probably benign Het
Or2t29 C T 11: 58,433,753 (GRCm39) C196Y probably damaging Het
Or5b120 A T 19: 13,479,943 (GRCm39) K79* probably null Het
Or6c216 A T 10: 129,678,625 (GRCm39) C95* probably null Het
Or8b1d A G 9: 38,558,620 (GRCm39) S67P probably damaging Het
Pcca T C 14: 122,901,717 (GRCm39) S287P probably damaging Het
Pitpnm3 T A 11: 71,955,069 (GRCm39) T482S probably benign Het
Pld2 C T 11: 70,445,893 (GRCm39) R676* probably null Het
Ppm1k T C 6: 57,491,057 (GRCm39) Y286C possibly damaging Het
Rb1 T C 14: 73,517,573 (GRCm39) N278D probably damaging Het
Sema3g T C 14: 30,943,783 (GRCm39) L221P probably damaging Het
Skint2 C T 4: 112,483,147 (GRCm39) T184I probably benign Het
Slc38a2 A G 15: 96,591,172 (GRCm39) F232S probably damaging Het
Snx6 T C 12: 54,814,811 (GRCm39) N170S probably benign Het
Sox9 T A 11: 112,673,416 (GRCm39) N2K probably damaging Het
Sp140l1 G C 1: 85,075,344 (GRCm39) probably null Het
Srpk2 T C 5: 23,729,604 (GRCm39) E345G probably benign Het
Tbc1d21 T C 9: 58,268,487 (GRCm39) M291V possibly damaging Het
Tekt2 T C 4: 126,218,693 (GRCm39) N20S probably benign Het
Tnxb T G 17: 34,914,578 (GRCm39) I1888S possibly damaging Het
Tsnaxip1 G A 8: 106,566,685 (GRCm39) E174K probably damaging Het
Ttc28 G A 5: 111,433,140 (GRCm39) R2058Q probably benign Het
Ttn C T 2: 76,715,357 (GRCm39) E7912K unknown Het
Ttyh2 T A 11: 114,601,667 (GRCm39) D430E probably benign Het
Vcan A T 13: 89,853,491 (GRCm39) S490T probably damaging Het
Vmn1r86 T A 7: 12,836,741 (GRCm39) D45V probably damaging Het
Wdr12 A G 1: 60,127,226 (GRCm39) V143A possibly damaging Het
Zbtb18 T A 1: 177,274,989 (GRCm39) Y116* probably null Het
Zdbf2 C T 1: 63,342,536 (GRCm39) T305I possibly damaging Het
Zfp384 T A 6: 125,007,802 (GRCm39) M244K possibly damaging Het
Zfp423 A T 8: 88,414,595 (GRCm39) V1241D probably damaging Het
Zfp574 A G 7: 24,780,640 (GRCm39) Y554C probably damaging Het
Zfp616 T C 11: 73,976,220 (GRCm39) S830P probably damaging Het
Zfp839 A G 12: 110,834,776 (GRCm39) Y677C probably benign Het
Other mutations in Ubr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Ubr2 APN 17 47,296,986 (GRCm39) splice site probably benign
IGL00332:Ubr2 APN 17 47,301,916 (GRCm39) critical splice donor site probably null
IGL00518:Ubr2 APN 17 47,303,922 (GRCm39) missense probably damaging 1.00
IGL00693:Ubr2 APN 17 47,283,907 (GRCm39) missense probably benign 0.01
IGL00785:Ubr2 APN 17 47,255,791 (GRCm39) missense possibly damaging 0.69
IGL01144:Ubr2 APN 17 47,268,247 (GRCm39) missense probably damaging 1.00
IGL01459:Ubr2 APN 17 47,241,435 (GRCm39) splice site probably benign
IGL01637:Ubr2 APN 17 47,267,580 (GRCm39) missense probably damaging 1.00
IGL01710:Ubr2 APN 17 47,254,335 (GRCm39) missense probably benign 0.00
IGL01726:Ubr2 APN 17 47,303,907 (GRCm39) splice site probably benign
IGL01925:Ubr2 APN 17 47,265,875 (GRCm39) missense possibly damaging 0.92
IGL01960:Ubr2 APN 17 47,284,893 (GRCm39) missense probably benign 0.45
IGL02170:Ubr2 APN 17 47,278,123 (GRCm39) missense probably benign 0.05
IGL02308:Ubr2 APN 17 47,245,119 (GRCm39) missense probably damaging 1.00
IGL02387:Ubr2 APN 17 47,274,076 (GRCm39) missense probably benign
IGL02696:Ubr2 APN 17 47,274,691 (GRCm39) missense probably benign
IGL02726:Ubr2 APN 17 47,283,847 (GRCm39) missense probably damaging 1.00
IGL02750:Ubr2 APN 17 47,280,208 (GRCm39) missense probably benign 0.00
IGL02934:Ubr2 APN 17 47,268,266 (GRCm39) missense possibly damaging 0.50
IGL02959:Ubr2 APN 17 47,286,877 (GRCm39) missense probably damaging 0.96
IGL03018:Ubr2 APN 17 47,264,972 (GRCm39) missense possibly damaging 0.64
IGL03343:Ubr2 APN 17 47,262,844 (GRCm39) missense probably benign 0.00
PIT4280001:Ubr2 UTSW 17 47,255,789 (GRCm39) missense probably damaging 1.00
R0044:Ubr2 UTSW 17 47,303,911 (GRCm39) splice site probably benign
R0044:Ubr2 UTSW 17 47,303,911 (GRCm39) splice site probably benign
R0446:Ubr2 UTSW 17 47,294,224 (GRCm39) missense probably damaging 1.00
R0513:Ubr2 UTSW 17 47,297,705 (GRCm39) nonsense probably null
R0565:Ubr2 UTSW 17 47,266,812 (GRCm39) missense probably damaging 1.00
R0600:Ubr2 UTSW 17 47,278,174 (GRCm39) missense probably damaging 0.99
R0690:Ubr2 UTSW 17 47,249,579 (GRCm39) missense probably damaging 0.97
R0710:Ubr2 UTSW 17 47,249,607 (GRCm39) missense probably damaging 0.96
R0761:Ubr2 UTSW 17 47,294,242 (GRCm39) missense probably damaging 1.00
R0798:Ubr2 UTSW 17 47,280,102 (GRCm39) splice site probably benign
R0862:Ubr2 UTSW 17 47,278,009 (GRCm39) nonsense probably null
R0947:Ubr2 UTSW 17 47,252,038 (GRCm39) missense probably damaging 0.99
R0972:Ubr2 UTSW 17 47,245,187 (GRCm39) splice site probably null
R1500:Ubr2 UTSW 17 47,297,615 (GRCm39) missense possibly damaging 0.79
R1514:Ubr2 UTSW 17 47,311,749 (GRCm39) missense probably damaging 1.00
R1533:Ubr2 UTSW 17 47,278,173 (GRCm39) nonsense probably null
R1554:Ubr2 UTSW 17 47,283,877 (GRCm39) missense probably benign
R1575:Ubr2 UTSW 17 47,243,418 (GRCm39) missense probably damaging 1.00
R1602:Ubr2 UTSW 17 47,251,987 (GRCm39) missense probably benign 0.30
R1941:Ubr2 UTSW 17 47,284,952 (GRCm39) missense probably damaging 1.00
R1966:Ubr2 UTSW 17 47,265,845 (GRCm39) missense probably benign 0.05
R2041:Ubr2 UTSW 17 47,296,973 (GRCm39) missense probably damaging 1.00
R2067:Ubr2 UTSW 17 47,274,071 (GRCm39) critical splice donor site probably null
R2111:Ubr2 UTSW 17 47,274,071 (GRCm39) critical splice donor site probably null
R2189:Ubr2 UTSW 17 47,254,290 (GRCm39) missense probably benign 0.01
R2219:Ubr2 UTSW 17 47,296,968 (GRCm39) missense possibly damaging 0.94
R2307:Ubr2 UTSW 17 47,277,141 (GRCm39) nonsense probably null
R3426:Ubr2 UTSW 17 47,279,365 (GRCm39) missense probably damaging 1.00
R3428:Ubr2 UTSW 17 47,279,365 (GRCm39) missense probably damaging 1.00
R3608:Ubr2 UTSW 17 47,255,449 (GRCm39) missense probably damaging 1.00
R4080:Ubr2 UTSW 17 47,299,648 (GRCm39) missense probably benign 0.05
R4330:Ubr2 UTSW 17 47,278,204 (GRCm39) missense probably null 1.00
R4383:Ubr2 UTSW 17 47,250,313 (GRCm39) missense probably benign 0.01
R4460:Ubr2 UTSW 17 47,255,971 (GRCm39) critical splice donor site probably null
R4794:Ubr2 UTSW 17 47,241,371 (GRCm39) missense probably damaging 1.00
R4902:Ubr2 UTSW 17 47,296,922 (GRCm39) missense possibly damaging 0.91
R4913:Ubr2 UTSW 17 47,270,385 (GRCm39) splice site probably null
R5092:Ubr2 UTSW 17 47,280,173 (GRCm39) missense probably damaging 1.00
R5209:Ubr2 UTSW 17 47,279,350 (GRCm39) missense probably damaging 1.00
R5226:Ubr2 UTSW 17 47,294,196 (GRCm39) missense probably benign 0.04
R5250:Ubr2 UTSW 17 47,241,368 (GRCm39) missense probably benign 0.01
R5437:Ubr2 UTSW 17 47,274,623 (GRCm39) missense probably benign 0.00
R5607:Ubr2 UTSW 17 47,245,126 (GRCm39) nonsense probably null
R5848:Ubr2 UTSW 17 47,267,581 (GRCm39) missense possibly damaging 0.84
R6089:Ubr2 UTSW 17 47,293,218 (GRCm39) missense possibly damaging 0.95
R6382:Ubr2 UTSW 17 47,268,241 (GRCm39) missense possibly damaging 0.56
R6552:Ubr2 UTSW 17 47,277,194 (GRCm39) splice site probably null
R6630:Ubr2 UTSW 17 47,262,910 (GRCm39) missense possibly damaging 0.51
R6892:Ubr2 UTSW 17 47,245,034 (GRCm39) missense probably damaging 0.99
R6936:Ubr2 UTSW 17 47,283,957 (GRCm39) missense possibly damaging 0.94
R7039:Ubr2 UTSW 17 47,321,139 (GRCm39) missense probably benign 0.01
R7050:Ubr2 UTSW 17 47,272,528 (GRCm39) missense probably benign 0.30
R7078:Ubr2 UTSW 17 47,266,779 (GRCm39) missense possibly damaging 0.59
R7126:Ubr2 UTSW 17 47,284,982 (GRCm39) splice site probably null
R7219:Ubr2 UTSW 17 47,246,360 (GRCm39) nonsense probably null
R7262:Ubr2 UTSW 17 47,311,665 (GRCm39) missense probably damaging 0.97
R7352:Ubr2 UTSW 17 47,241,352 (GRCm39) missense probably benign 0.19
R7366:Ubr2 UTSW 17 47,266,771 (GRCm39) missense probably damaging 0.99
R7449:Ubr2 UTSW 17 47,275,714 (GRCm39) missense probably damaging 1.00
R7496:Ubr2 UTSW 17 47,301,917 (GRCm39) critical splice donor site probably null
R7759:Ubr2 UTSW 17 47,296,974 (GRCm39) missense probably damaging 1.00
R7869:Ubr2 UTSW 17 47,301,934 (GRCm39) missense probably benign 0.00
R7916:Ubr2 UTSW 17 47,279,308 (GRCm39) critical splice donor site probably null
R8236:Ubr2 UTSW 17 47,262,835 (GRCm39) missense probably benign
R8376:Ubr2 UTSW 17 47,253,721 (GRCm39) missense probably benign 0.07
R9026:Ubr2 UTSW 17 47,245,041 (GRCm39) missense probably damaging 1.00
R9216:Ubr2 UTSW 17 47,292,285 (GRCm39) missense probably benign 0.36
R9339:Ubr2 UTSW 17 47,284,865 (GRCm39) missense probably benign 0.30
R9558:Ubr2 UTSW 17 47,262,843 (GRCm39) missense probably benign
R9644:Ubr2 UTSW 17 47,266,706 (GRCm39) critical splice donor site probably null
R9731:Ubr2 UTSW 17 47,274,071 (GRCm39) critical splice donor site probably null
X0027:Ubr2 UTSW 17 47,311,555 (GRCm39) missense probably damaging 0.99
X0061:Ubr2 UTSW 17 47,281,037 (GRCm39) missense possibly damaging 0.88
Z1177:Ubr2 UTSW 17 47,311,692 (GRCm39) missense possibly damaging 0.76
Z1177:Ubr2 UTSW 17 47,270,435 (GRCm39) missense probably benign
Z1177:Ubr2 UTSW 17 47,321,069 (GRCm39) missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- ATCGCCCCACATTTAAGGAGG -3'
(R):5'- CAGATTATTTTCCAGGGTGCTCTG -3'

Sequencing Primer
(F):5'- CCCACATTTAAGGAGGCACAAAGG -3'
(R):5'- GTGCCTGTTCCTTTGTAACAG -3'
Posted On 2022-09-12