Incidental Mutation 'R9607:Flg2'
ID 723917
Institutional Source Beutler Lab
Gene Symbol Flg2
Ensembl Gene ENSMUSG00000049133
Gene Name filaggrin family member 2
Synonyms EG229574
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock # R9607 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 93197278-93221391 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 93201412 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 249 (Y249C)
Ref Sequence ENSEMBL: ENSMUSP00000096482 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098884]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000098884
AA Change: Y249C

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000096482
Gene: ENSMUSG00000049133
AA Change: Y249C

DomainStartEndE-ValueType
Pfam:S_100 4 46 1.2e-17 PFAM
low complexity region 58 70 N/A INTRINSIC
low complexity region 110 121 N/A INTRINSIC
low complexity region 131 146 N/A INTRINSIC
low complexity region 207 223 N/A INTRINSIC
internal_repeat_2 230 347 7.36e-7 PROSPERO
internal_repeat_2 349 466 7.36e-7 PROSPERO
internal_repeat_3 366 392 6.93e-6 PROSPERO
internal_repeat_6 419 471 4.17e-5 PROSPERO
low complexity region 474 550 N/A INTRINSIC
low complexity region 567 589 N/A INTRINSIC
low complexity region 593 679 N/A INTRINSIC
low complexity region 680 705 N/A INTRINSIC
low complexity region 719 748 N/A INTRINSIC
low complexity region 749 768 N/A INTRINSIC
low complexity region 772 800 N/A INTRINSIC
internal_repeat_5 804 825 4.17e-5 PROSPERO
internal_repeat_3 810 836 6.93e-6 PROSPERO
low complexity region 846 860 N/A INTRINSIC
low complexity region 863 885 N/A INTRINSIC
internal_repeat_5 895 919 4.17e-5 PROSPERO
internal_repeat_4 899 939 1.7e-5 PROSPERO
internal_repeat_1 944 1461 8.08e-127 PROSPERO
internal_repeat_6 1335 1386 4.17e-5 PROSPERO
low complexity region 1465 1485 N/A INTRINSIC
internal_repeat_1 1486 2009 8.08e-127 PROSPERO
internal_repeat_4 2123 2173 1.7e-5 PROSPERO
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aak1 T C 6: 86,937,086 probably null Het
Atp8a1 T C 5: 67,659,907 Y927C Het
BC037034 T C 5: 138,261,600 D398G probably damaging Het
Bckdhb A G 9: 83,989,291 I208V probably benign Het
Cacna1g T C 11: 94,465,888 I141V probably benign Het
Celsr1 A G 15: 86,031,028 S915P Het
Celsr3 G A 9: 108,840,502 probably null Het
Cep295 A T 9: 15,322,713 D2262E probably damaging Het
Chil3 T C 3: 106,160,369 K160R probably null Het
Cmtr1 G T 17: 29,674,222 A72S probably benign Het
Cpa5 T C 6: 30,626,339 F233S probably damaging Het
Creb3l3 G A 10: 81,084,901 R432W probably damaging Het
Csdc2 A G 15: 81,946,887 D45G possibly damaging Het
Csmd3 G T 15: 47,755,415 T1859K probably damaging Het
Cxxc1 T C 18: 74,220,408 probably null Het
Dcc A G 18: 71,588,001 S430P probably damaging Het
Dera T G 6: 137,856,734 S270A unknown Het
Dnaaf1 A G 8: 119,582,611 E146G possibly damaging Het
Dsg4 A T 18: 20,452,990 T246S probably benign Het
Eif4g3 A G 4: 138,165,734 E766G probably benign Het
Ep400 A C 5: 110,683,939 C2146G unknown Het
Epas1 A T 17: 86,826,610 T516S probably benign Het
Espn A G 4: 152,135,482 S395P probably benign Het
Fam124b T A 1: 80,213,096 Q190L probably damaging Het
Filip1 T A 9: 79,819,120 D739V probably damaging Het
Gm9008 A T 6: 76,496,940 L231* probably null Het
Gon4l T A 3: 88,858,444 S391T probably damaging Het
Hoxa5 G T 6: 52,204,216 Y45* probably null Het
Ift172 A G 5: 31,253,569 F1715S Het
Klhdc9 T A 1: 171,359,556 H262L probably damaging Het
Krt16 C A 11: 100,247,627 D232Y probably damaging Het
Lrrd1 A G 5: 3,851,561 E622G probably damaging Het
Mars A T 10: 127,308,624 C182* probably null Het
Mcm5 C T 8: 75,117,540 S313F probably benign Het
Msrb2 C A 2: 19,394,319 N164K probably damaging Het
Muc2 T A 7: 141,751,453 C604S Het
Mup17 T C 4: 61,593,666 I124V probably benign Het
Myo18b T C 5: 112,874,678 M283V unknown Het
Ndn C T 7: 62,348,589 P61L possibly damaging Het
Nepro T C 16: 44,731,469 L230P probably damaging Het
Nes A G 3: 87,976,206 N591D probably benign Het
Nfrkb T C 9: 31,414,770 S1170P possibly damaging Het
Nphs1 A T 7: 30,463,587 T430S probably damaging Het
Nrp1 T C 8: 128,425,781 V157A probably benign Het
Nup188 T A 2: 30,307,712 D259E probably benign Het
Olfr1463 A T 19: 13,234,589 N113I Het
Olfr466 G T 13: 65,153,071 M282I probably benign Het
Olfr669 T C 7: 104,939,000 M158T probably benign Het
Olfr905 A G 9: 38,473,617 Y290C probably damaging Het
Park2 A G 17: 12,004,076 Y371C probably damaging Het
Pcdha8 T A 18: 36,993,164 L233Q probably damaging Het
Pcdhga12 T A 18: 37,768,336 F740L probably damaging Het
Pglyrp4 G A 3: 90,730,844 G155D probably damaging Het
Piezo2 G A 18: 63,386,276 probably benign Het
Pirb G A 7: 3,717,618 R294C possibly damaging Het
Ppil1 A T 17: 29,251,507 *167K probably null Het
Prdm10 G T 9: 31,349,190 D647Y probably damaging Het
Prrc2b T A 2: 32,208,782 I702N probably damaging Het
Rtp4 T A 16: 23,520,476 probably null Het
Sema6c A G 3: 95,169,234 H277R probably benign Het
Slc14a1 C A 18: 78,109,592 A367S probably damaging Het
Slc41a2 A G 10: 83,283,767 L377P probably damaging Het
Soga1 T G 2: 157,027,568 E1049A probably damaging Het
Svil T C 18: 5,058,126 Y630H possibly damaging Het
Tbata A G 10: 61,175,847 H54R probably benign Het
Tnfaip2 C A 12: 111,445,635 Q157K possibly damaging Het
Ttn C T 2: 76,885,013 E7912K unknown Het
Vmn2r74 T A 7: 85,961,411 R24S probably benign Het
Vmn2r90 G A 17: 17,733,376 V601M possibly damaging Het
Vmn2r-ps117 A G 17: 18,823,678 T339A probably benign Het
Xirp2 C T 2: 67,510,762 H1116Y possibly damaging Het
Xrcc1 A G 7: 24,566,265 D156G probably benign Het
Other mutations in Flg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Flg2 APN 3 93202109 nonsense probably null
IGL00092:Flg2 APN 3 93219855 missense possibly damaging 0.90
IGL00985:Flg2 APN 3 93203278 missense unknown
IGL01077:Flg2 APN 3 93220206 missense unknown
IGL01093:Flg2 APN 3 93202371 missense unknown
IGL01120:Flg2 APN 3 93201168 missense probably damaging 0.99
IGL01473:Flg2 APN 3 93203020 missense unknown
IGL01584:Flg2 APN 3 93213466 missense unknown
IGL01584:Flg2 APN 3 93215470 missense unknown
IGL01686:Flg2 APN 3 93202284 missense unknown
IGL02207:Flg2 APN 3 93220128 missense unknown
IGL02294:Flg2 APN 3 93203746 missense unknown
IGL02418:Flg2 APN 3 93201054 missense probably benign 0.26
IGL02581:Flg2 APN 3 93219892 missense unknown
IGL02719:Flg2 APN 3 93220131 nonsense probably null
IGL02795:Flg2 APN 3 93203613 missense unknown
IGL02893:Flg2 APN 3 93203613 missense unknown
IGL02958:Flg2 APN 3 93203613 missense unknown
IGL03060:Flg2 APN 3 93203613 missense unknown
IGL03088:Flg2 APN 3 93203191 missense unknown
IGL03165:Flg2 APN 3 93214611 missense unknown
IGL03342:Flg2 APN 3 93201235 missense probably damaging 1.00
IGL03352:Flg2 APN 3 93202494 missense unknown
IGL02796:Flg2 UTSW 3 93203613 missense unknown
IGL02837:Flg2 UTSW 3 93201737 missense probably damaging 1.00
PIT4618001:Flg2 UTSW 3 93203781 missense unknown
R0087:Flg2 UTSW 3 93202431 missense unknown
R0233:Flg2 UTSW 3 93201797 nonsense probably null
R0233:Flg2 UTSW 3 93201797 nonsense probably null
R0315:Flg2 UTSW 3 93214722 missense unknown
R0390:Flg2 UTSW 3 93200355 splice site probably benign
R0462:Flg2 UTSW 3 93201437 missense probably benign 0.18
R0553:Flg2 UTSW 3 93203584 missense unknown
R0828:Flg2 UTSW 3 93203332 missense unknown
R1006:Flg2 UTSW 3 93201207 missense probably benign 0.41
R1444:Flg2 UTSW 3 93202313 missense unknown
R1497:Flg2 UTSW 3 93219769 missense unknown
R1518:Flg2 UTSW 3 93203138 missense unknown
R1737:Flg2 UTSW 3 93203621 missense unknown
R1780:Flg2 UTSW 3 93202999 missense unknown
R1797:Flg2 UTSW 3 93200976 missense probably damaging 1.00
R2065:Flg2 UTSW 3 93202231 missense unknown
R2168:Flg2 UTSW 3 93201937 missense probably damaging 1.00
R2220:Flg2 UTSW 3 93202185 missense unknown
R2292:Flg2 UTSW 3 93220677 missense unknown
R2327:Flg2 UTSW 3 93203606 nonsense probably null
R2512:Flg2 UTSW 3 93201775 missense probably damaging 1.00
R3177:Flg2 UTSW 3 93214888 missense unknown
R3277:Flg2 UTSW 3 93214888 missense unknown
R3522:Flg2 UTSW 3 93220027 missense unknown
R3779:Flg2 UTSW 3 93202423 missense unknown
R3926:Flg2 UTSW 3 93203215 missense unknown
R4082:Flg2 UTSW 3 93203521 missense unknown
R4407:Flg2 UTSW 3 93214869 missense unknown
R5152:Flg2 UTSW 3 93214977 missense unknown
R5253:Flg2 UTSW 3 93200812 missense probably damaging 1.00
R5290:Flg2 UTSW 3 93220566 missense unknown
R5464:Flg2 UTSW 3 93201970 missense possibly damaging 0.73
R5539:Flg2 UTSW 3 93220446 missense unknown
R5622:Flg2 UTSW 3 93202564 missense unknown
R5788:Flg2 UTSW 3 93200989 missense probably benign 0.41
R5792:Flg2 UTSW 3 93203497 missense unknown
R5831:Flg2 UTSW 3 93200234 missense probably damaging 1.00
R5877:Flg2 UTSW 3 93203449 missense unknown
R6041:Flg2 UTSW 3 93220361 missense probably benign 0.01
R6189:Flg2 UTSW 3 93220074 missense unknown
R6214:Flg2 UTSW 3 93201859 missense possibly damaging 0.83
R6215:Flg2 UTSW 3 93201859 missense possibly damaging 0.83
R6239:Flg2 UTSW 3 93201272 missense probably benign 0.36
R6288:Flg2 UTSW 3 93203785 missense unknown
R6413:Flg2 UTSW 3 93220376 missense unknown
R6457:Flg2 UTSW 3 93220482 missense unknown
R6468:Flg2 UTSW 3 93214421 missense unknown
R6667:Flg2 UTSW 3 93201761 missense possibly damaging 0.88
R6930:Flg2 UTSW 3 93201335 nonsense probably null
R6996:Flg2 UTSW 3 93202670 missense unknown
R6996:Flg2 UTSW 3 93202949 missense unknown
R7100:Flg2 UTSW 3 93203711 missense unknown
R7133:Flg2 UTSW 3 93219762 missense unknown
R7180:Flg2 UTSW 3 93202833 missense unknown
R7325:Flg2 UTSW 3 93203372 missense unknown
R7349:Flg2 UTSW 3 93220206 missense unknown
R7531:Flg2 UTSW 3 93200870 missense probably damaging 0.99
R7571:Flg2 UTSW 3 93219996 nonsense probably null
R7684:Flg2 UTSW 3 93219649 missense unknown
R7810:Flg2 UTSW 3 93200241 missense possibly damaging 0.70
R7853:Flg2 UTSW 3 93220747 missense unknown
R8031:Flg2 UTSW 3 93220214 missense unknown
R8078:Flg2 UTSW 3 93200275 missense probably damaging 1.00
R8142:Flg2 UTSW 3 93215475 nonsense probably null
R8156:Flg2 UTSW 3 93220083 missense unknown
R8172:Flg2 UTSW 3 93201161 missense possibly damaging 0.94
R8204:Flg2 UTSW 3 93202767 missense unknown
R8262:Flg2 UTSW 3 93220210 missense unknown
R8269:Flg2 UTSW 3 93201880 missense possibly damaging 0.68
R8290:Flg2 UTSW 3 93202762 missense unknown
R8444:Flg2 UTSW 3 93200278 missense probably damaging 0.97
R8670:Flg2 UTSW 3 93201484 missense probably damaging 0.97
R8755:Flg2 UTSW 3 93200813 missense probably damaging 1.00
R9039:Flg2 UTSW 3 93203592 missense unknown
R9116:Flg2 UTSW 3 93202284 missense unknown
R9214:Flg2 UTSW 3 93203577 missense unknown
R9231:Flg2 UTSW 3 93202201 missense unknown
R9553:Flg2 UTSW 3 93214594 missense unknown
R9735:Flg2 UTSW 3 93220362 missense unknown
R9752:Flg2 UTSW 3 93201160 missense probably damaging 0.98
Z1177:Flg2 UTSW 3 93202420 missense unknown
Z1177:Flg2 UTSW 3 93202738 missense unknown
Predicted Primers PCR Primer
(F):5'- ACCATGGGTCTATCTTTGGTC -3'
(R):5'- GTACGGCAAGACTGATTTCCTTG -3'

Sequencing Primer
(F):5'- TGGTCACTCTTGGAGTAGTAACAAAG -3'
(R):5'- AAGACTGATTTCCTTGTCCCTGTG -3'
Posted On 2022-09-12