Mutagenetix > Incidental Mutation

Incidental Mutation 'R9607:Ep400'

723926

Institutional Source

Beutler Lab

Gene Symbol

Ep400

Ensembl Gene

ENSMUSG00000029505

Gene Name

E1A binding protein p400

Synonyms

mDomino, 1700020J09Rik, p400

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R9607 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

110664373-110770717 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 110683939 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Glycine at position 2146 (C2146G)

Ref Sequence

ENSEMBL: ENSMUSP00000049038 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041558] [ENSMUST00000112435] [ENSMUST00000112436]

AlphaFold

no structure available at present

Predicted Effect

unknown
Transcript: ENSMUST00000041558
AA Change: C2146G

SMART Domains

Protein: ENSMUSP00000049038
Gene: ENSMUSG00000029505
AA Change: C2146G

Domain	Start	End	E-Value	Type
Pfam:EP400_N	1	461	1.6e-232	PFAM
low complexity region	519	532	N/A	INTRINSIC
low complexity region	550	561	N/A	INTRINSIC
low complexity region	598	620	N/A	INTRINSIC
low complexity region	631	645	N/A	INTRINSIC
low complexity region	658	686	N/A	INTRINSIC
HSA	762	833	1.31e-31	SMART
low complexity region	908	925	N/A	INTRINSIC
DEXDc	1049	1238	2.76e-15	SMART
Blast:DEXDc	1276	1317	2e-15	BLAST
low complexity region	1407	1417	N/A	INTRINSIC
HELICc	1807	1893	1.17e-4	SMART
low complexity region	2006	2019	N/A	INTRINSIC
low complexity region	2080	2100	N/A	INTRINSIC
low complexity region	2214	2223	N/A	INTRINSIC
SANT	2243	2310	3.57e-1	SMART
low complexity region	2402	2489	N/A	INTRINSIC
low complexity region	2596	2608	N/A	INTRINSIC
low complexity region	2644	2679	N/A	INTRINSIC
low complexity region	2694	2738	N/A	INTRINSIC
low complexity region	2769	2806	N/A	INTRINSIC
low complexity region	2846	2883	N/A	INTRINSIC
low complexity region	2933	2947	N/A	INTRINSIC
low complexity region	2974	2986	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000112435
AA Change: C2027G

SMART Domains

Protein: ENSMUSP00000108054
Gene: ENSMUSG00000029505
AA Change: C2027G

Domain	Start	End	E-Value	Type
low complexity region	28	53	N/A	INTRINSIC
low complexity region	121	145	N/A	INTRINSIC
low complexity region	262	287	N/A	INTRINSIC
low complexity region	298	308	N/A	INTRINSIC
low complexity region	313	329	N/A	INTRINSIC
coiled coil region	418	447	N/A	INTRINSIC
low complexity region	471	485	N/A	INTRINSIC
low complexity region	556	569	N/A	INTRINSIC
low complexity region	587	598	N/A	INTRINSIC
low complexity region	635	657	N/A	INTRINSIC
low complexity region	668	682	N/A	INTRINSIC
low complexity region	695	723	N/A	INTRINSIC
HSA	799	870	1.31e-31	SMART
low complexity region	945	962	N/A	INTRINSIC
DEXDc	1086	1275	2.76e-15	SMART
Blast:DEXDc	1313	1354	2e-15	BLAST
low complexity region	1444	1454	N/A	INTRINSIC
internal_repeat_1	1556	1646	6.82e-5	PROSPERO
low complexity region	1887	1900	N/A	INTRINSIC
low complexity region	1961	1981	N/A	INTRINSIC
low complexity region	2095	2104	N/A	INTRINSIC
SANT	2124	2191	3.57e-1	SMART
low complexity region	2283	2370	N/A	INTRINSIC
internal_repeat_1	2371	2463	6.82e-5	PROSPERO
low complexity region	2477	2489	N/A	INTRINSIC
low complexity region	2525	2560	N/A	INTRINSIC
low complexity region	2575	2619	N/A	INTRINSIC
low complexity region	2645	2659	N/A	INTRINSIC
low complexity region	2660	2680	N/A	INTRINSIC
low complexity region	2720	2757	N/A	INTRINSIC
low complexity region	2807	2821	N/A	INTRINSIC
low complexity region	2848	2860	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000112436
AA Change: C2110G

SMART Domains

Protein: ENSMUSP00000108055
Gene: ENSMUSG00000029505
AA Change: C2110G

Domain	Start	End	E-Value	Type
low complexity region	28	53	N/A	INTRINSIC
low complexity region	121	145	N/A	INTRINSIC
low complexity region	262	287	N/A	INTRINSIC
low complexity region	298	308	N/A	INTRINSIC
low complexity region	313	329	N/A	INTRINSIC
coiled coil region	418	449	N/A	INTRINSIC
low complexity region	472	482	N/A	INTRINSIC
low complexity region	483	496	N/A	INTRINSIC
low complexity region	514	525	N/A	INTRINSIC
low complexity region	562	584	N/A	INTRINSIC
low complexity region	595	609	N/A	INTRINSIC
low complexity region	622	650	N/A	INTRINSIC
HSA	726	797	1.31e-31	SMART
low complexity region	872	889	N/A	INTRINSIC
DEXDc	1013	1202	2.76e-15	SMART
Blast:DEXDc	1240	1281	2e-15	BLAST
low complexity region	1371	1381	N/A	INTRINSIC
internal_repeat_1	1483	1573	6.76e-5	PROSPERO
HELICc	1771	1857	1.17e-4	SMART
low complexity region	1970	1983	N/A	INTRINSIC
low complexity region	2044	2064	N/A	INTRINSIC
low complexity region	2178	2187	N/A	INTRINSIC
SANT	2207	2274	3.57e-1	SMART
low complexity region	2366	2453	N/A	INTRINSIC
internal_repeat_1	2454	2546	6.76e-5	PROSPERO
low complexity region	2560	2572	N/A	INTRINSIC
low complexity region	2608	2643	N/A	INTRINSIC
low complexity region	2658	2702	N/A	INTRINSIC
low complexity region	2733	2770	N/A	INTRINSIC
low complexity region	2810	2847	N/A	INTRINSIC
low complexity region	2897	2911	N/A	INTRINSIC
low complexity region	2938	2950	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.7%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele die at E11.5 and display severe defects in yolk sac erythropoiesis, anemia, and a slight deformity of the neural tube. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aak1	T	C	6: 86,937,086		probably null	Het
Atp8a1	T	C	5: 67,659,907	Y927C		Het
BC037034	T	C	5: 138,261,600	D398G	probably damaging	Het
Bckdhb	A	G	9: 83,989,291	I208V	probably benign	Het
Cacna1g	T	C	11: 94,465,888	I141V	probably benign	Het
Celsr1	A	G	15: 86,031,028	S915P		Het
Celsr3	G	A	9: 108,840,502		probably null	Het
Cep295	A	T	9: 15,322,713	D2262E	probably damaging	Het
Chil3	T	C	3: 106,160,369	K160R	probably null	Het
Cmtr1	G	T	17: 29,674,222	A72S	probably benign	Het
Cpa5	T	C	6: 30,626,339	F233S	probably damaging	Het
Creb3l3	G	A	10: 81,084,901	R432W	probably damaging	Het
Csdc2	A	G	15: 81,946,887	D45G	possibly damaging	Het
Csmd3	G	T	15: 47,755,415	T1859K	probably damaging	Het
Cxxc1	T	C	18: 74,220,408		probably null	Het
Dcc	A	G	18: 71,588,001	S430P	probably damaging	Het
Dera	T	G	6: 137,856,734	S270A	unknown	Het
Dnaaf1	A	G	8: 119,582,611	E146G	possibly damaging	Het
Dsg4	A	T	18: 20,452,990	T246S	probably benign	Het
Eif4g3	A	G	4: 138,165,734	E766G	probably benign	Het
Epas1	A	T	17: 86,826,610	T516S	probably benign	Het
Espn	A	G	4: 152,135,482	S395P	probably benign	Het
Fam124b	T	A	1: 80,213,096	Q190L	probably damaging	Het
Filip1	T	A	9: 79,819,120	D739V	probably damaging	Het
Flg2	A	G	3: 93,201,412	Y249C	probably damaging	Het
Gm9008	A	T	6: 76,496,940	L231*	probably null	Het
Gon4l	T	A	3: 88,858,444	S391T	probably damaging	Het
Hoxa5	G	T	6: 52,204,216	Y45*	probably null	Het
Ift172	A	G	5: 31,253,569	F1715S		Het
Klhdc9	T	A	1: 171,359,556	H262L	probably damaging	Het
Krt16	C	A	11: 100,247,627	D232Y	probably damaging	Het
Lrrd1	A	G	5: 3,851,561	E622G	probably damaging	Het
Mars	A	T	10: 127,308,624	C182*	probably null	Het
Mcm5	C	T	8: 75,117,540	S313F	probably benign	Het
Msrb2	C	A	2: 19,394,319	N164K	probably damaging	Het
Muc2	T	A	7: 141,751,453	C604S		Het
Mup17	T	C	4: 61,593,666	I124V	probably benign	Het
Myo18b	T	C	5: 112,874,678	M283V	unknown	Het
Ndn	C	T	7: 62,348,589	P61L	possibly damaging	Het
Nepro	T	C	16: 44,731,469	L230P	probably damaging	Het
Nes	A	G	3: 87,976,206	N591D	probably benign	Het
Nfrkb	T	C	9: 31,414,770	S1170P	possibly damaging	Het
Nphs1	A	T	7: 30,463,587	T430S	probably damaging	Het
Nrp1	T	C	8: 128,425,781	V157A	probably benign	Het
Nup188	T	A	2: 30,307,712	D259E	probably benign	Het
Olfr1463	A	T	19: 13,234,589	N113I		Het
Olfr466	G	T	13: 65,153,071	M282I	probably benign	Het
Olfr669	T	C	7: 104,939,000	M158T	probably benign	Het
Olfr905	A	G	9: 38,473,617	Y290C	probably damaging	Het
Park2	A	G	17: 12,004,076	Y371C	probably damaging	Het
Pcdha8	T	A	18: 36,993,164	L233Q	probably damaging	Het
Pcdhga12	T	A	18: 37,768,336	F740L	probably damaging	Het
Pglyrp4	G	A	3: 90,730,844	G155D	probably damaging	Het
Piezo2	G	A	18: 63,386,276		probably benign	Het
Pirb	G	A	7: 3,717,618	R294C	possibly damaging	Het
Ppil1	A	T	17: 29,251,507	*167K	probably null	Het
Prdm10	G	T	9: 31,349,190	D647Y	probably damaging	Het
Prrc2b	T	A	2: 32,208,782	I702N	probably damaging	Het
Rtp4	T	A	16: 23,520,476		probably null	Het
Sema6c	A	G	3: 95,169,234	H277R	probably benign	Het
Slc14a1	C	A	18: 78,109,592	A367S	probably damaging	Het
Slc41a2	A	G	10: 83,283,767	L377P	probably damaging	Het
Soga1	T	G	2: 157,027,568	E1049A	probably damaging	Het
Svil	T	C	18: 5,058,126	Y630H	possibly damaging	Het
Tbata	A	G	10: 61,175,847	H54R	probably benign	Het
Tnfaip2	C	A	12: 111,445,635	Q157K	possibly damaging	Het
Ttn	C	T	2: 76,885,013	E7912K	unknown	Het
Vmn2r74	T	A	7: 85,961,411	R24S	probably benign	Het
Vmn2r90	G	A	17: 17,733,376	V601M	possibly damaging	Het
Vmn2r-ps117	A	G	17: 18,823,678	T339A	probably benign	Het
Xirp2	C	T	2: 67,510,762	H1116Y	possibly damaging	Het
Xrcc1	A	G	7: 24,566,265	D156G	probably benign	Het

Other mutations in Ep400

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00231:Ep400	APN	5	110687841	missense	unknown
IGL00585:Ep400	APN	5	110755905	missense	possibly damaging	0.70
IGL00586:Ep400	APN	5	110739594	missense	probably damaging	1.00
IGL00816:Ep400	APN	5	110735490	unclassified	probably benign
IGL01066:Ep400	APN	5	110668199	splice site	probably benign
IGL01302:Ep400	APN	5	110742048	missense	probably benign	0.00
IGL01568:Ep400	APN	5	110719495	missense	unknown
IGL01833:Ep400	APN	5	110680008	missense	unknown
IGL02086:Ep400	APN	5	110676943	splice site	probably benign
IGL02266:Ep400	APN	5	110695297	unclassified	probably benign
IGL02288:Ep400	APN	5	110683836	splice site	probably benign
IGL02301:Ep400	APN	5	110674960	missense	probably damaging	1.00
IGL02377:Ep400	APN	5	110720825	missense	unknown
IGL02382:Ep400	APN	5	110701728	missense	unknown
IGL02419:Ep400	APN	5	110697376	splice site	probably null
IGL02591:Ep400	APN	5	110733772	unclassified	probably benign
IGL02981:Ep400	APN	5	110756103	missense	possibly damaging	0.79
IGL02981:Ep400	APN	5	110691610	splice site	probably benign
IGL03173:Ep400	APN	5	110708871	unclassified	probably benign
IGL03244:Ep400	APN	5	110727563	missense	unknown
IGL03333:Ep400	APN	5	110703566	missense	unknown
santol	UTSW	5	110701671	missense	unknown
PIT4243001:Ep400	UTSW	5	110735580	missense	unknown
PIT4260001:Ep400	UTSW	5	110693171	nonsense	probably null
R0017:Ep400	UTSW	5	110673529	missense	probably damaging	1.00
R0179:Ep400	UTSW	5	110668649	missense	probably damaging	0.99
R0243:Ep400	UTSW	5	110724407	splice site	probably benign
R0366:Ep400	UTSW	5	110701671	missense	unknown
R0508:Ep400	UTSW	5	110739508	missense	probably benign	0.00
R0541:Ep400	UTSW	5	110705016	missense	unknown
R0558:Ep400	UTSW	5	110685067	splice site	probably benign
R0576:Ep400	UTSW	5	110711093	unclassified	probably benign
R0595:Ep400	UTSW	5	110703542	missense	unknown
R0671:Ep400	UTSW	5	110688196	missense	unknown
R0763:Ep400	UTSW	5	110665837	missense	probably damaging	1.00
R1078:Ep400	UTSW	5	110735522	unclassified	probably benign
R1300:Ep400	UTSW	5	110673560	missense	probably damaging	1.00
R1439:Ep400	UTSW	5	110685478	missense	unknown
R1520:Ep400	UTSW	5	110691778	intron	probably benign
R1529:Ep400	UTSW	5	110739445	missense	probably benign	0.00
R1535:Ep400	UTSW	5	110708166	unclassified	probably benign
R1560:Ep400	UTSW	5	110671106	splice site	probably null
R1587:Ep400	UTSW	5	110726902	missense	probably benign	0.23
R1596:Ep400	UTSW	5	110708861	unclassified	probably benign
R1653:Ep400	UTSW	5	110693174	nonsense	probably null
R1711:Ep400	UTSW	5	110693308	unclassified	probably benign
R1774:Ep400	UTSW	5	110685491	missense	unknown
R1836:Ep400	UTSW	5	110705054	missense	unknown
R1905:Ep400	UTSW	5	110670948	missense	probably damaging	1.00
R1917:Ep400	UTSW	5	110703575	missense	unknown
R2064:Ep400	UTSW	5	110735404	unclassified	probably benign
R2122:Ep400	UTSW	5	110708850	unclassified	probably benign
R2144:Ep400	UTSW	5	110703518	missense	unknown
R2215:Ep400	UTSW	5	110693555	unclassified	probably benign
R2252:Ep400	UTSW	5	110719091	missense	unknown
R2253:Ep400	UTSW	5	110719091	missense	unknown
R2483:Ep400	UTSW	5	110719236	missense	unknown
R2504:Ep400	UTSW	5	110668645	missense	probably damaging	1.00
R2512:Ep400	UTSW	5	110708915	unclassified	probably benign
R2842:Ep400	UTSW	5	110698815	nonsense	probably null
R2920:Ep400	UTSW	5	110755914	missense	probably damaging	1.00
R3082:Ep400	UTSW	5	110693230	unclassified	probably benign
R3151:Ep400	UTSW	5	110703569	missense	unknown
R3552:Ep400	UTSW	5	110729287	missense	unknown
R3623:Ep400	UTSW	5	110719236	missense	unknown
R3779:Ep400	UTSW	5	110691649	missense	unknown
R3923:Ep400	UTSW	5	110756523	missense	possibly damaging	0.55
R4062:Ep400	UTSW	5	110741981	missense	probably benign	0.10
R4508:Ep400	UTSW	5	110703615	missense	unknown
R4584:Ep400	UTSW	5	110733897	unclassified	probably benign
R4585:Ep400	UTSW	5	110753859	missense	probably damaging	1.00
R4586:Ep400	UTSW	5	110753859	missense	probably damaging	1.00
R4807:Ep400	UTSW	5	110695578	splice site	probably null
R4921:Ep400	UTSW	5	110665810	missense	probably damaging	1.00
R4976:Ep400	UTSW	5	110698812	missense	unknown
R4976:Ep400	UTSW	5	110720756	missense	unknown
R5075:Ep400	UTSW	5	110685485	missense	unknown
R5120:Ep400	UTSW	5	110756358	missense	probably damaging	1.00
R5122:Ep400	UTSW	5	110668170	missense	probably damaging	1.00
R5223:Ep400	UTSW	5	110668630	missense	probably damaging	1.00
R5284:Ep400	UTSW	5	110668124	missense	probably damaging	1.00
R5388:Ep400	UTSW	5	110701728	missense	unknown
R5401:Ep400	UTSW	5	110683171	missense	unknown
R5431:Ep400	UTSW	5	110676554	missense	unknown
R5461:Ep400	UTSW	5	110676684	nonsense	probably null
R5568:Ep400	UTSW	5	110756205	missense	probably damaging	1.00
R5650:Ep400	UTSW	5	110695952	critical splice donor site	probably null
R5778:Ep400	UTSW	5	110719584	missense	unknown
R5806:Ep400	UTSW	5	110755554	nonsense	probably null
R5814:Ep400	UTSW	5	110695578	splice site	probably null
R5830:Ep400	UTSW	5	110683996	missense	unknown
R5882:Ep400	UTSW	5	110755587	missense	probably benign	0.00
R5931:Ep400	UTSW	5	110735520	unclassified	probably benign
R5945:Ep400	UTSW	5	110682866	missense	unknown
R5966:Ep400	UTSW	5	110676900	missense	unknown
R5973:Ep400	UTSW	5	110729831	missense	unknown
R5980:Ep400	UTSW	5	110733729	unclassified	probably benign
R6000:Ep400	UTSW	5	110683201	missense	unknown
R6006:Ep400	UTSW	5	110704959	missense	unknown
R6053:Ep400	UTSW	5	110755795	missense	probably benign	0.22
R6145:Ep400	UTSW	5	110756703	missense	possibly damaging	0.95
R6154:Ep400	UTSW	5	110755933	missense	probably damaging	0.97
R6169:Ep400	UTSW	5	110741997	missense	possibly damaging	0.83
R6228:Ep400	UTSW	5	110670942	missense	probably damaging	1.00
R6295:Ep400	UTSW	5	110753809	missense	probably benign	0.00
R6486:Ep400	UTSW	5	110697218	unclassified	probably benign
R6504:Ep400	UTSW	5	110708837	unclassified	probably benign
R6607:Ep400	UTSW	5	110683314	missense	unknown
R6657:Ep400	UTSW	5	110693545	unclassified	probably benign
R6660:Ep400	UTSW	5	110719447	nonsense	probably null
R6741:Ep400	UTSW	5	110676895	missense	unknown
R6933:Ep400	UTSW	5	110665862	missense	probably damaging	1.00
R6937:Ep400	UTSW	5	110711152	unclassified	probably benign
R7069:Ep400	UTSW	5	110668124	missense	probably damaging	1.00
R7103:Ep400	UTSW	5	110733785	missense	unknown
R7156:Ep400	UTSW	5	110685363	missense	unknown
R7272:Ep400	UTSW	5	110755645	nonsense	probably null
R7365:Ep400	UTSW	5	110719614	missense	unknown
R7581:Ep400	UTSW	5	110756025	missense	unknown
R7684:Ep400	UTSW	5	110697352	missense	unknown
R7699:Ep400	UTSW	5	110696032	missense	unknown
R7700:Ep400	UTSW	5	110696032	missense	unknown
R7856:Ep400	UTSW	5	110666584	missense	probably damaging	0.99
R7954:Ep400	UTSW	5	110668733	missense	possibly damaging	0.46
R8098:Ep400	UTSW	5	110693251	missense	unknown
R8108:Ep400	UTSW	5	110687883	missense	unknown
R8260:Ep400	UTSW	5	110755612	nonsense	probably null
R8293:Ep400	UTSW	5	110708892	missense	unknown
R8314:Ep400	UTSW	5	110755753	missense	unknown
R8351:Ep400	UTSW	5	110739334	missense	probably damaging	1.00
R8424:Ep400	UTSW	5	110693278	missense	unknown
R8459:Ep400	UTSW	5	110708891	missense	unknown
R8529:Ep400	UTSW	5	110719236	missense	unknown
R8688:Ep400	UTSW	5	110720819	missense	unknown
R8744:Ep400	UTSW	5	110742059	missense	unknown
R8923:Ep400	UTSW	5	110683998	missense	unknown
R9005:Ep400	UTSW	5	110711093	missense	unknown
R9087:Ep400	UTSW	5	110667564	nonsense	probably null
R9146:Ep400	UTSW	5	110701769	nonsense	probably null
R9383:Ep400	UTSW	5	110685485	missense	unknown
R9479:Ep400	UTSW	5	110729864	missense	unknown
R9496:Ep400	UTSW	5	110707987	missense	unknown
R9582:Ep400	UTSW	5	110676449	critical splice donor site	probably null
R9712:Ep400	UTSW	5	110756643	missense	unknown
R9746:Ep400	UTSW	5	110742006	missense	unknown
X0012:Ep400	UTSW	5	110673196	small deletion	probably benign
X0021:Ep400	UTSW	5	110682864	missense	unknown
Z1176:Ep400	UTSW	5	110756635	missense	unknown
Z1177:Ep400	UTSW	5	110683364	missense	unknown
Z1177:Ep400	UTSW	5	110733743	missense	unknown
Z1188:Ep400	UTSW	5	110755683	missense	unknown

Predicted Primers

PCR Primer
(F):5'- TCAAGCTTCTTCCCCTAAAATAGG -3'
(R):5'- ACAAACAGAAGTCATGCCGG -3'

Sequencing Primer
(F):5'- AGACAATGGATGGGTCCCTC -3'
(R):5'- AAGTCATGCCGGTATGTGACC -3'

Posted On

2022-09-12