Incidental Mutation 'R9607:Nphs1'
ID 723936
Institutional Source Beutler Lab
Gene Symbol Nphs1
Ensembl Gene ENSMUSG00000006649
Gene Name nephrosis 1, nephrin
Synonyms nephrin
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9607 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 30458315-30487223 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 30463587 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 430 (T430S)
Ref Sequence ENSEMBL: ENSMUSP00000006825 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006825] [ENSMUST00000126297]
AlphaFold Q9QZS7
Predicted Effect probably damaging
Transcript: ENSMUST00000006825
AA Change: T430S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000006825
Gene: ENSMUSG00000006649
AA Change: T430S

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
IG 52 146 1.38e-6 SMART
Pfam:C2-set_2 152 242 4.1e-20 PFAM
IG 264 351 9.86e-3 SMART
IG_like 360 452 2.73e1 SMART
IG 464 556 2.99e-2 SMART
IG_like 572 644 8.9e-1 SMART
IG 667 751 1.32e-3 SMART
IG 760 849 7.3e-6 SMART
IGc2 868 941 5.4e-9 SMART
FN3 955 1036 1.01e-11 SMART
transmembrane domain 1078 1100 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000126297
AA Change: T416S

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000116500
Gene: ENSMUSG00000006649
AA Change: T416S

DomainStartEndE-ValueType
IG 38 132 1.38e-6 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the immunoglobulin family of cell adhesion molecules that functions in the glomerular filtration barrier in the kidney. The gene is primarily expressed in renal tissues, and the protein is a type-1 transmembrane protein found at the slit diaphragm of glomerular podocytes. The slit diaphragm is thought to function as an ultrafilter to exclude albumin and other plasma macromolecules in the formation of urine. Mutations in this gene result in Finnish-type congenital nephrosis 1, characterized by severe proteinuria and loss of the slit diaphragm and foot processes.[provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit severe proteinuria associated with kidney defects and die soon after birth. Heterozygotes exhibit fusion of one-third of glomerular foot processes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aak1 T C 6: 86,937,086 probably null Het
Atp8a1 T C 5: 67,659,907 Y927C Het
BC037034 T C 5: 138,261,600 D398G probably damaging Het
Bckdhb A G 9: 83,989,291 I208V probably benign Het
Cacna1g T C 11: 94,465,888 I141V probably benign Het
Celsr1 A G 15: 86,031,028 S915P Het
Celsr3 G A 9: 108,840,502 probably null Het
Cep295 A T 9: 15,322,713 D2262E probably damaging Het
Chil3 T C 3: 106,160,369 K160R probably null Het
Cmtr1 G T 17: 29,674,222 A72S probably benign Het
Cpa5 T C 6: 30,626,339 F233S probably damaging Het
Creb3l3 G A 10: 81,084,901 R432W probably damaging Het
Csdc2 A G 15: 81,946,887 D45G possibly damaging Het
Csmd3 G T 15: 47,755,415 T1859K probably damaging Het
Cxxc1 T C 18: 74,220,408 probably null Het
Dcc A G 18: 71,588,001 S430P probably damaging Het
Dera T G 6: 137,856,734 S270A unknown Het
Dnaaf1 A G 8: 119,582,611 E146G possibly damaging Het
Dsg4 A T 18: 20,452,990 T246S probably benign Het
Eif4g3 A G 4: 138,165,734 E766G probably benign Het
Ep400 A C 5: 110,683,939 C2146G unknown Het
Epas1 A T 17: 86,826,610 T516S probably benign Het
Espn A G 4: 152,135,482 S395P probably benign Het
Fam124b T A 1: 80,213,096 Q190L probably damaging Het
Filip1 T A 9: 79,819,120 D739V probably damaging Het
Flg2 A G 3: 93,201,412 Y249C probably damaging Het
Gm9008 A T 6: 76,496,940 L231* probably null Het
Gon4l T A 3: 88,858,444 S391T probably damaging Het
Hoxa5 G T 6: 52,204,216 Y45* probably null Het
Ift172 A G 5: 31,253,569 F1715S Het
Klhdc9 T A 1: 171,359,556 H262L probably damaging Het
Krt16 C A 11: 100,247,627 D232Y probably damaging Het
Lrrd1 A G 5: 3,851,561 E622G probably damaging Het
Mars A T 10: 127,308,624 C182* probably null Het
Mcm5 C T 8: 75,117,540 S313F probably benign Het
Msrb2 C A 2: 19,394,319 N164K probably damaging Het
Muc2 T A 7: 141,751,453 C604S Het
Mup17 T C 4: 61,593,666 I124V probably benign Het
Myo18b T C 5: 112,874,678 M283V unknown Het
Ndn C T 7: 62,348,589 P61L possibly damaging Het
Nepro T C 16: 44,731,469 L230P probably damaging Het
Nes A G 3: 87,976,206 N591D probably benign Het
Nfrkb T C 9: 31,414,770 S1170P possibly damaging Het
Nrp1 T C 8: 128,425,781 V157A probably benign Het
Nup188 T A 2: 30,307,712 D259E probably benign Het
Olfr1463 A T 19: 13,234,589 N113I Het
Olfr466 G T 13: 65,153,071 M282I probably benign Het
Olfr669 T C 7: 104,939,000 M158T probably benign Het
Olfr905 A G 9: 38,473,617 Y290C probably damaging Het
Park2 A G 17: 12,004,076 Y371C probably damaging Het
Pcdha8 T A 18: 36,993,164 L233Q probably damaging Het
Pcdhga12 T A 18: 37,768,336 F740L probably damaging Het
Pglyrp4 G A 3: 90,730,844 G155D probably damaging Het
Piezo2 G A 18: 63,386,276 probably benign Het
Pirb G A 7: 3,717,618 R294C possibly damaging Het
Ppil1 A T 17: 29,251,507 *167K probably null Het
Prdm10 G T 9: 31,349,190 D647Y probably damaging Het
Prrc2b T A 2: 32,208,782 I702N probably damaging Het
Rtp4 T A 16: 23,520,476 probably null Het
Sema6c A G 3: 95,169,234 H277R probably benign Het
Slc14a1 C A 18: 78,109,592 A367S probably damaging Het
Slc41a2 A G 10: 83,283,767 L377P probably damaging Het
Soga1 T G 2: 157,027,568 E1049A probably damaging Het
Svil T C 18: 5,058,126 Y630H possibly damaging Het
Tbata A G 10: 61,175,847 H54R probably benign Het
Tnfaip2 C A 12: 111,445,635 Q157K possibly damaging Het
Ttn C T 2: 76,885,013 E7912K unknown Het
Vmn2r74 T A 7: 85,961,411 R24S probably benign Het
Vmn2r90 G A 17: 17,733,376 V601M possibly damaging Het
Vmn2r-ps117 A G 17: 18,823,678 T339A probably benign Het
Xirp2 C T 2: 67,510,762 H1116Y possibly damaging Het
Xrcc1 A G 7: 24,566,265 D156G probably benign Het
Other mutations in Nphs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Nphs1 APN 7 30482551 missense possibly damaging 0.77
IGL00927:Nphs1 APN 7 30460739 unclassified probably benign
IGL00976:Nphs1 APN 7 30460685 missense possibly damaging 0.78
IGL01397:Nphs1 APN 7 30486664 missense probably benign 0.01
IGL01465:Nphs1 APN 7 30486714 makesense probably null
IGL01889:Nphs1 APN 7 30460511 missense probably damaging 1.00
IGL02383:Nphs1 APN 7 30481635 splice site probably benign
R0020:Nphs1 UTSW 7 30463208 missense probably benign 0.01
R0485:Nphs1 UTSW 7 30467515 missense probably benign
R1024:Nphs1 UTSW 7 30474277 missense probably damaging 1.00
R1115:Nphs1 UTSW 7 30481378 splice site probably benign
R1144:Nphs1 UTSW 7 30481678 splice site probably benign
R1289:Nphs1 UTSW 7 30471178 missense probably damaging 1.00
R1317:Nphs1 UTSW 7 30481831 splice site probably benign
R1617:Nphs1 UTSW 7 30482531 missense probably benign
R1756:Nphs1 UTSW 7 30461534 missense probably benign 0.00
R1937:Nphs1 UTSW 7 30474373 missense probably damaging 1.00
R2144:Nphs1 UTSW 7 30460970 missense probably benign 0.13
R2256:Nphs1 UTSW 7 30467992 missense possibly damaging 0.94
R2257:Nphs1 UTSW 7 30467992 missense possibly damaging 0.94
R2277:Nphs1 UTSW 7 30467564 nonsense probably null
R3104:Nphs1 UTSW 7 30467540 nonsense probably null
R3106:Nphs1 UTSW 7 30467540 nonsense probably null
R3151:Nphs1 UTSW 7 30460240 missense probably benign
R3765:Nphs1 UTSW 7 30471210 missense probably damaging 0.98
R4078:Nphs1 UTSW 7 30467520 nonsense probably null
R4397:Nphs1 UTSW 7 30481965 splice site probably null
R4635:Nphs1 UTSW 7 30468007 missense probably benign 0.39
R4650:Nphs1 UTSW 7 30482470 missense probably benign 0.21
R4811:Nphs1 UTSW 7 30460429 missense probably damaging 1.00
R4850:Nphs1 UTSW 7 30463232 missense possibly damaging 0.78
R5272:Nphs1 UTSW 7 30481642 missense possibly damaging 0.86
R5327:Nphs1 UTSW 7 30463825 missense probably benign 0.00
R5681:Nphs1 UTSW 7 30486625 missense probably benign 0.00
R5865:Nphs1 UTSW 7 30474385 missense probably damaging 1.00
R5975:Nphs1 UTSW 7 30466115 missense possibly damaging 0.82
R6186:Nphs1 UTSW 7 30465634 missense probably damaging 0.98
R6198:Nphs1 UTSW 7 30467915 missense probably damaging 0.97
R6353:Nphs1 UTSW 7 30474544 missense probably damaging 0.99
R7405:Nphs1 UTSW 7 30462828 missense possibly damaging 0.46
R7647:Nphs1 UTSW 7 30481965 splice site probably null
R7767:Nphs1 UTSW 7 30463308 missense probably damaging 1.00
R8132:Nphs1 UTSW 7 30482053 missense probably benign 0.02
R8485:Nphs1 UTSW 7 30466173 missense probably damaging 0.98
R8678:Nphs1 UTSW 7 30463859 missense probably damaging 1.00
R8890:Nphs1 UTSW 7 30462655 missense probably damaging 1.00
R8946:Nphs1 UTSW 7 30463200 missense probably damaging 1.00
R9133:Nphs1 UTSW 7 30460667 nonsense probably null
R9159:Nphs1 UTSW 7 30465601 missense possibly damaging 0.93
R9347:Nphs1 UTSW 7 30471169 missense probably damaging 1.00
R9547:Nphs1 UTSW 7 30481450 missense probably benign 0.00
R9548:Nphs1 UTSW 7 30481450 missense probably benign 0.00
R9626:Nphs1 UTSW 7 30467566 missense probably benign 0.16
R9720:Nphs1 UTSW 7 30466074 missense possibly damaging 0.83
R9733:Nphs1 UTSW 7 30467530 missense probably damaging 1.00
X0028:Nphs1 UTSW 7 30467504 missense probably null 0.01
Z1177:Nphs1 UTSW 7 30470903 missense probably damaging 1.00
Z1186:Nphs1 UTSW 7 30460350 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGTTCCTGGGTCTTATAGAGG -3'
(R):5'- TCAATCCACAGCTTCTGGGC -3'

Sequencing Primer
(F):5'- GATGGGAAAGTTTCATGTGTCC -3'
(R):5'- GATGGTGAAGAGACACATTTACATC -3'
Posted On 2022-09-12