Incidental Mutation 'R9607:Filip1'
ID 723948
Institutional Source Beutler Lab
Gene Symbol Filip1
Ensembl Gene ENSMUSG00000034898
Gene Name filamin A interacting protein 1
Synonyms 5730485H21Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.381) question?
Stock # R9607 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 79815051-80012851 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 79819120 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 739 (D739V)
Ref Sequence ENSEMBL: ENSMUSP00000091329 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093811] [ENSMUST00000172973]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000093811
AA Change: D739V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000091329
Gene: ENSMUSG00000034898
AA Change: D739V

DomainStartEndE-ValueType
Pfam:CortBP2 71 256 2.1e-64 PFAM
coiled coil region 258 540 N/A INTRINSIC
low complexity region 545 564 N/A INTRINSIC
low complexity region 579 592 N/A INTRINSIC
coiled coil region 625 778 N/A INTRINSIC
low complexity region 928 940 N/A INTRINSIC
low complexity region 1126 1140 N/A INTRINSIC
low complexity region 1168 1180 N/A INTRINSIC
low complexity region 1198 1214 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172973
SMART Domains Protein: ENSMUSP00000134427
Gene: ENSMUSG00000034898

DomainStartEndE-ValueType
Pfam:CortBP2 65 225 5.2e-74 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a filamin A binding protein. The encoded protein promotes the degradation of filamin A and may regulate cortical neuron migration and dendritic spine morphology. Mice lacking a functional copy of this gene exhibit reduced dendritic spine length and altered excitatory signaling. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aak1 T C 6: 86,937,086 probably null Het
Atp8a1 T C 5: 67,659,907 Y927C Het
BC037034 T C 5: 138,261,600 D398G probably damaging Het
Bckdhb A G 9: 83,989,291 I208V probably benign Het
Cacna1g T C 11: 94,465,888 I141V probably benign Het
Celsr1 A G 15: 86,031,028 S915P Het
Celsr3 G A 9: 108,840,502 probably null Het
Cep295 A T 9: 15,322,713 D2262E probably damaging Het
Chil3 T C 3: 106,160,369 K160R probably null Het
Cmtr1 G T 17: 29,674,222 A72S probably benign Het
Cpa5 T C 6: 30,626,339 F233S probably damaging Het
Creb3l3 G A 10: 81,084,901 R432W probably damaging Het
Csdc2 A G 15: 81,946,887 D45G possibly damaging Het
Csmd3 G T 15: 47,755,415 T1859K probably damaging Het
Cxxc1 T C 18: 74,220,408 probably null Het
Dcc A G 18: 71,588,001 S430P probably damaging Het
Dera T G 6: 137,856,734 S270A unknown Het
Dnaaf1 A G 8: 119,582,611 E146G possibly damaging Het
Dsg4 A T 18: 20,452,990 T246S probably benign Het
Eif4g3 A G 4: 138,165,734 E766G probably benign Het
Ep400 A C 5: 110,683,939 C2146G unknown Het
Epas1 A T 17: 86,826,610 T516S probably benign Het
Espn A G 4: 152,135,482 S395P probably benign Het
Fam124b T A 1: 80,213,096 Q190L probably damaging Het
Flg2 A G 3: 93,201,412 Y249C probably damaging Het
Gm9008 A T 6: 76,496,940 L231* probably null Het
Gon4l T A 3: 88,858,444 S391T probably damaging Het
Hoxa5 G T 6: 52,204,216 Y45* probably null Het
Ift172 A G 5: 31,253,569 F1715S Het
Klhdc9 T A 1: 171,359,556 H262L probably damaging Het
Krt16 C A 11: 100,247,627 D232Y probably damaging Het
Lrrd1 A G 5: 3,851,561 E622G probably damaging Het
Mars A T 10: 127,308,624 C182* probably null Het
Mcm5 C T 8: 75,117,540 S313F probably benign Het
Msrb2 C A 2: 19,394,319 N164K probably damaging Het
Muc2 T A 7: 141,751,453 C604S Het
Mup17 T C 4: 61,593,666 I124V probably benign Het
Myo18b T C 5: 112,874,678 M283V unknown Het
Ndn C T 7: 62,348,589 P61L possibly damaging Het
Nepro T C 16: 44,731,469 L230P probably damaging Het
Nes A G 3: 87,976,206 N591D probably benign Het
Nfrkb T C 9: 31,414,770 S1170P possibly damaging Het
Nphs1 A T 7: 30,463,587 T430S probably damaging Het
Nrp1 T C 8: 128,425,781 V157A probably benign Het
Nup188 T A 2: 30,307,712 D259E probably benign Het
Olfr1463 A T 19: 13,234,589 N113I Het
Olfr466 G T 13: 65,153,071 M282I probably benign Het
Olfr669 T C 7: 104,939,000 M158T probably benign Het
Olfr905 A G 9: 38,473,617 Y290C probably damaging Het
Park2 A G 17: 12,004,076 Y371C probably damaging Het
Pcdha8 T A 18: 36,993,164 L233Q probably damaging Het
Pcdhga12 T A 18: 37,768,336 F740L probably damaging Het
Pglyrp4 G A 3: 90,730,844 G155D probably damaging Het
Piezo2 G A 18: 63,386,276 probably benign Het
Pirb G A 7: 3,717,618 R294C possibly damaging Het
Ppil1 A T 17: 29,251,507 *167K probably null Het
Prdm10 G T 9: 31,349,190 D647Y probably damaging Het
Prrc2b T A 2: 32,208,782 I702N probably damaging Het
Rtp4 T A 16: 23,520,476 probably null Het
Sema6c A G 3: 95,169,234 H277R probably benign Het
Slc14a1 C A 18: 78,109,592 A367S probably damaging Het
Slc41a2 A G 10: 83,283,767 L377P probably damaging Het
Soga1 T G 2: 157,027,568 E1049A probably damaging Het
Svil T C 18: 5,058,126 Y630H possibly damaging Het
Tbata A G 10: 61,175,847 H54R probably benign Het
Tnfaip2 C A 12: 111,445,635 Q157K possibly damaging Het
Ttn C T 2: 76,885,013 E7912K unknown Het
Vmn2r74 T A 7: 85,961,411 R24S probably benign Het
Vmn2r90 G A 17: 17,733,376 V601M possibly damaging Het
Vmn2r-ps117 A G 17: 18,823,678 T339A probably benign Het
Xirp2 C T 2: 67,510,762 H1116Y possibly damaging Het
Xrcc1 A G 7: 24,566,265 D156G probably benign Het
Other mutations in Filip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Filip1 APN 9 79817944 missense probably damaging 1.00
IGL01101:Filip1 APN 9 79898246 missense probably benign 0.44
IGL01301:Filip1 APN 9 79819180 missense possibly damaging 0.93
IGL01887:Filip1 APN 9 79819617 missense probably benign 0.42
IGL02119:Filip1 APN 9 79818266 missense probably benign
IGL02285:Filip1 APN 9 79820126 missense probably damaging 1.00
IGL02395:Filip1 APN 9 79898410 missense probably benign 0.01
IGL03398:Filip1 APN 9 79818943 missense probably benign 0.03
IGL03400:Filip1 APN 9 79820473 missense probably benign 0.01
IGL03404:Filip1 APN 9 79818559 missense probably damaging 0.99
ANU18:Filip1 UTSW 9 79819180 missense possibly damaging 0.93
BB010:Filip1 UTSW 9 79820047 missense possibly damaging 0.65
BB020:Filip1 UTSW 9 79820047 missense possibly damaging 0.65
R0101:Filip1 UTSW 9 79819528 missense probably benign 0.04
R0243:Filip1 UTSW 9 79819003 missense probably damaging 0.98
R0244:Filip1 UTSW 9 79819462 missense possibly damaging 0.87
R0371:Filip1 UTSW 9 79860091 missense probably damaging 1.00
R0399:Filip1 UTSW 9 79818310 missense possibly damaging 0.71
R0412:Filip1 UTSW 9 79820289 missense possibly damaging 0.59
R0671:Filip1 UTSW 9 79819390 missense probably damaging 1.00
R1314:Filip1 UTSW 9 79820566 missense probably damaging 1.00
R1465:Filip1 UTSW 9 79898307 missense probably benign 0.25
R1465:Filip1 UTSW 9 79898307 missense probably benign 0.25
R1602:Filip1 UTSW 9 79820591 missense probably damaging 0.99
R1801:Filip1 UTSW 9 79815846 missense probably damaging 0.98
R1929:Filip1 UTSW 9 79819930 missense probably damaging 1.00
R1983:Filip1 UTSW 9 79860092 missense probably damaging 1.00
R2066:Filip1 UTSW 9 79820216 missense probably damaging 1.00
R2128:Filip1 UTSW 9 79819330 missense probably damaging 0.99
R2271:Filip1 UTSW 9 79819930 missense probably damaging 1.00
R2411:Filip1 UTSW 9 79898433 missense probably damaging 0.98
R3429:Filip1 UTSW 9 79853670 missense probably damaging 1.00
R3430:Filip1 UTSW 9 79853670 missense probably damaging 1.00
R3945:Filip1 UTSW 9 79818367 missense probably benign 0.01
R4007:Filip1 UTSW 9 79818727 missense possibly damaging 0.71
R4583:Filip1 UTSW 9 79815809 missense possibly damaging 0.76
R4803:Filip1 UTSW 9 79820114 missense probably benign 0.05
R4837:Filip1 UTSW 9 79819459 missense probably damaging 0.98
R4910:Filip1 UTSW 9 79817932 missense probably benign 0.00
R4929:Filip1 UTSW 9 79819747 missense probably benign 0.07
R5387:Filip1 UTSW 9 79818274 missense probably benign
R5581:Filip1 UTSW 9 79819760 missense possibly damaging 0.95
R5808:Filip1 UTSW 9 79818701 missense possibly damaging 0.67
R5891:Filip1 UTSW 9 79819860 missense possibly damaging 0.69
R6166:Filip1 UTSW 9 79819454 missense probably damaging 0.99
R6273:Filip1 UTSW 9 79815886 missense probably benign 0.01
R6380:Filip1 UTSW 9 79819624 missense probably damaging 0.99
R6385:Filip1 UTSW 9 79820531 missense possibly damaging 0.68
R6614:Filip1 UTSW 9 79815839 missense probably damaging 1.00
R6715:Filip1 UTSW 9 79818758 missense probably benign 0.03
R7047:Filip1 UTSW 9 79853634 missense probably damaging 0.98
R7126:Filip1 UTSW 9 79898295 missense possibly damaging 0.88
R7144:Filip1 UTSW 9 79820213 missense possibly damaging 0.65
R7218:Filip1 UTSW 9 79818074 missense probably benign
R7404:Filip1 UTSW 9 79820098 missense possibly damaging 0.94
R7702:Filip1 UTSW 9 79820649 missense probably benign 0.20
R7866:Filip1 UTSW 9 79818943 missense probably benign 0.03
R7933:Filip1 UTSW 9 79820047 missense possibly damaging 0.65
R8012:Filip1 UTSW 9 79817959 missense probably damaging 0.97
R8097:Filip1 UTSW 9 79818259 missense probably benign
R8213:Filip1 UTSW 9 79818092 missense probably benign 0.01
R8305:Filip1 UTSW 9 79820475 nonsense probably null
R8798:Filip1 UTSW 9 79820090 missense possibly damaging 0.94
R9184:Filip1 UTSW 9 79898260 missense probably benign 0.03
R9322:Filip1 UTSW 9 79819732 missense probably benign 0.01
R9334:Filip1 UTSW 9 79818457 missense probably benign 0.32
R9353:Filip1 UTSW 9 79818341 missense possibly damaging 0.67
R9541:Filip1 UTSW 9 79819853 nonsense probably null
X0054:Filip1 UTSW 9 79819535 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GATTTGCGGATGAACACAGC -3'
(R):5'- GGAAATTAAGCACCAAATGGCC -3'

Sequencing Primer
(F):5'- ATGAACACAGCCGGGGTCTC -3'
(R):5'- TTAAGCACCAAATGGCCAAGAAC -3'
Posted On 2022-09-12