Mutagenetix > Incidental Mutation

Incidental Mutation 'R9607:Filip1'

723948

Institutional Source

Beutler Lab

Gene Symbol

Filip1

Ensembl Gene

ENSMUSG00000034898

Gene Name

filamin A interacting protein 1

Synonyms

5730485H21Rik

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.381) question?

Stock #

R9607 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

79815051-80012851 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 79819120 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 739 (D739V)

Ref Sequence

ENSEMBL: ENSMUSP00000091329 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000093811] [ENSMUST00000172973]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000093811
AA Change: D739V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000091329
Gene: ENSMUSG00000034898
AA Change: D739V

Domain	Start	End	E-Value	Type
Pfam:CortBP2	71	256	2.1e-64	PFAM
coiled coil region	258	540	N/A	INTRINSIC
low complexity region	545	564	N/A	INTRINSIC
low complexity region	579	592	N/A	INTRINSIC
coiled coil region	625	778	N/A	INTRINSIC
low complexity region	928	940	N/A	INTRINSIC
low complexity region	1126	1140	N/A	INTRINSIC
low complexity region	1168	1180	N/A	INTRINSIC
low complexity region	1198	1214	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000172973

SMART Domains

Protein: ENSMUSP00000134427
Gene: ENSMUSG00000034898

Domain	Start	End	E-Value	Type
Pfam:CortBP2	65	225	5.2e-74	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a filamin A binding protein. The encoded protein promotes the degradation of filamin A and may regulate cortical neuron migration and dendritic spine morphology. Mice lacking a functional copy of this gene exhibit reduced dendritic spine length and altered excitatory signaling. [provided by RefSeq, Oct 2016]

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aak1	T	C	6: 86,937,086		probably null	Het
Atp8a1	T	C	5: 67,659,907	Y927C		Het
BC037034	T	C	5: 138,261,600	D398G	probably damaging	Het
Bckdhb	A	G	9: 83,989,291	I208V	probably benign	Het
Cacna1g	T	C	11: 94,465,888	I141V	probably benign	Het
Celsr1	A	G	15: 86,031,028	S915P		Het
Celsr3	G	A	9: 108,840,502		probably null	Het
Cep295	A	T	9: 15,322,713	D2262E	probably damaging	Het
Chil3	T	C	3: 106,160,369	K160R	probably null	Het
Cmtr1	G	T	17: 29,674,222	A72S	probably benign	Het
Cpa5	T	C	6: 30,626,339	F233S	probably damaging	Het
Creb3l3	G	A	10: 81,084,901	R432W	probably damaging	Het
Csdc2	A	G	15: 81,946,887	D45G	possibly damaging	Het
Csmd3	G	T	15: 47,755,415	T1859K	probably damaging	Het
Cxxc1	T	C	18: 74,220,408		probably null	Het
Dcc	A	G	18: 71,588,001	S430P	probably damaging	Het
Dera	T	G	6: 137,856,734	S270A	unknown	Het
Dnaaf1	A	G	8: 119,582,611	E146G	possibly damaging	Het
Dsg4	A	T	18: 20,452,990	T246S	probably benign	Het
Eif4g3	A	G	4: 138,165,734	E766G	probably benign	Het
Ep400	A	C	5: 110,683,939	C2146G	unknown	Het
Epas1	A	T	17: 86,826,610	T516S	probably benign	Het
Espn	A	G	4: 152,135,482	S395P	probably benign	Het
Fam124b	T	A	1: 80,213,096	Q190L	probably damaging	Het
Flg2	A	G	3: 93,201,412	Y249C	probably damaging	Het
Gm9008	A	T	6: 76,496,940	L231*	probably null	Het
Gon4l	T	A	3: 88,858,444	S391T	probably damaging	Het
Hoxa5	G	T	6: 52,204,216	Y45*	probably null	Het
Ift172	A	G	5: 31,253,569	F1715S		Het
Klhdc9	T	A	1: 171,359,556	H262L	probably damaging	Het
Krt16	C	A	11: 100,247,627	D232Y	probably damaging	Het
Lrrd1	A	G	5: 3,851,561	E622G	probably damaging	Het
Mars	A	T	10: 127,308,624	C182*	probably null	Het
Mcm5	C	T	8: 75,117,540	S313F	probably benign	Het
Msrb2	C	A	2: 19,394,319	N164K	probably damaging	Het
Muc2	T	A	7: 141,751,453	C604S		Het
Mup17	T	C	4: 61,593,666	I124V	probably benign	Het
Myo18b	T	C	5: 112,874,678	M283V	unknown	Het
Ndn	C	T	7: 62,348,589	P61L	possibly damaging	Het
Nepro	T	C	16: 44,731,469	L230P	probably damaging	Het
Nes	A	G	3: 87,976,206	N591D	probably benign	Het
Nfrkb	T	C	9: 31,414,770	S1170P	possibly damaging	Het
Nphs1	A	T	7: 30,463,587	T430S	probably damaging	Het
Nrp1	T	C	8: 128,425,781	V157A	probably benign	Het
Nup188	T	A	2: 30,307,712	D259E	probably benign	Het
Olfr1463	A	T	19: 13,234,589	N113I		Het
Olfr466	G	T	13: 65,153,071	M282I	probably benign	Het
Olfr669	T	C	7: 104,939,000	M158T	probably benign	Het
Olfr905	A	G	9: 38,473,617	Y290C	probably damaging	Het
Park2	A	G	17: 12,004,076	Y371C	probably damaging	Het
Pcdha8	T	A	18: 36,993,164	L233Q	probably damaging	Het
Pcdhga12	T	A	18: 37,768,336	F740L	probably damaging	Het
Pglyrp4	G	A	3: 90,730,844	G155D	probably damaging	Het
Piezo2	G	A	18: 63,386,276		probably benign	Het
Pirb	G	A	7: 3,717,618	R294C	possibly damaging	Het
Ppil1	A	T	17: 29,251,507	*167K	probably null	Het
Prdm10	G	T	9: 31,349,190	D647Y	probably damaging	Het
Prrc2b	T	A	2: 32,208,782	I702N	probably damaging	Het
Rtp4	T	A	16: 23,520,476		probably null	Het
Sema6c	A	G	3: 95,169,234	H277R	probably benign	Het
Slc14a1	C	A	18: 78,109,592	A367S	probably damaging	Het
Slc41a2	A	G	10: 83,283,767	L377P	probably damaging	Het
Soga1	T	G	2: 157,027,568	E1049A	probably damaging	Het
Svil	T	C	18: 5,058,126	Y630H	possibly damaging	Het
Tbata	A	G	10: 61,175,847	H54R	probably benign	Het
Tnfaip2	C	A	12: 111,445,635	Q157K	possibly damaging	Het
Ttn	C	T	2: 76,885,013	E7912K	unknown	Het
Vmn2r74	T	A	7: 85,961,411	R24S	probably benign	Het
Vmn2r90	G	A	17: 17,733,376	V601M	possibly damaging	Het
Vmn2r-ps117	A	G	17: 18,823,678	T339A	probably benign	Het
Xirp2	C	T	2: 67,510,762	H1116Y	possibly damaging	Het
Xrcc1	A	G	7: 24,566,265	D156G	probably benign	Het

Other mutations in Filip1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00420:Filip1	APN	9	79817944	missense	probably damaging	1.00
IGL01101:Filip1	APN	9	79898246	missense	probably benign	0.44
IGL01301:Filip1	APN	9	79819180	missense	possibly damaging	0.93
IGL01887:Filip1	APN	9	79819617	missense	probably benign	0.42
IGL02119:Filip1	APN	9	79818266	missense	probably benign
IGL02285:Filip1	APN	9	79820126	missense	probably damaging	1.00
IGL02395:Filip1	APN	9	79898410	missense	probably benign	0.01
IGL03398:Filip1	APN	9	79818943	missense	probably benign	0.03
IGL03400:Filip1	APN	9	79820473	missense	probably benign	0.01
IGL03404:Filip1	APN	9	79818559	missense	probably damaging	0.99
ANU18:Filip1	UTSW	9	79819180	missense	possibly damaging	0.93
BB010:Filip1	UTSW	9	79820047	missense	possibly damaging	0.65
BB020:Filip1	UTSW	9	79820047	missense	possibly damaging	0.65
R0101:Filip1	UTSW	9	79819528	missense	probably benign	0.04
R0243:Filip1	UTSW	9	79819003	missense	probably damaging	0.98
R0244:Filip1	UTSW	9	79819462	missense	possibly damaging	0.87
R0371:Filip1	UTSW	9	79860091	missense	probably damaging	1.00
R0399:Filip1	UTSW	9	79818310	missense	possibly damaging	0.71
R0412:Filip1	UTSW	9	79820289	missense	possibly damaging	0.59
R0671:Filip1	UTSW	9	79819390	missense	probably damaging	1.00
R1314:Filip1	UTSW	9	79820566	missense	probably damaging	1.00
R1465:Filip1	UTSW	9	79898307	missense	probably benign	0.25
R1465:Filip1	UTSW	9	79898307	missense	probably benign	0.25
R1602:Filip1	UTSW	9	79820591	missense	probably damaging	0.99
R1801:Filip1	UTSW	9	79815846	missense	probably damaging	0.98
R1929:Filip1	UTSW	9	79819930	missense	probably damaging	1.00
R1983:Filip1	UTSW	9	79860092	missense	probably damaging	1.00
R2066:Filip1	UTSW	9	79820216	missense	probably damaging	1.00
R2128:Filip1	UTSW	9	79819330	missense	probably damaging	0.99
R2271:Filip1	UTSW	9	79819930	missense	probably damaging	1.00
R2411:Filip1	UTSW	9	79898433	missense	probably damaging	0.98
R3429:Filip1	UTSW	9	79853670	missense	probably damaging	1.00
R3430:Filip1	UTSW	9	79853670	missense	probably damaging	1.00
R3945:Filip1	UTSW	9	79818367	missense	probably benign	0.01
R4007:Filip1	UTSW	9	79818727	missense	possibly damaging	0.71
R4583:Filip1	UTSW	9	79815809	missense	possibly damaging	0.76
R4803:Filip1	UTSW	9	79820114	missense	probably benign	0.05
R4837:Filip1	UTSW	9	79819459	missense	probably damaging	0.98
R4910:Filip1	UTSW	9	79817932	missense	probably benign	0.00
R4929:Filip1	UTSW	9	79819747	missense	probably benign	0.07
R5387:Filip1	UTSW	9	79818274	missense	probably benign
R5581:Filip1	UTSW	9	79819760	missense	possibly damaging	0.95
R5808:Filip1	UTSW	9	79818701	missense	possibly damaging	0.67
R5891:Filip1	UTSW	9	79819860	missense	possibly damaging	0.69
R6166:Filip1	UTSW	9	79819454	missense	probably damaging	0.99
R6273:Filip1	UTSW	9	79815886	missense	probably benign	0.01
R6380:Filip1	UTSW	9	79819624	missense	probably damaging	0.99
R6385:Filip1	UTSW	9	79820531	missense	possibly damaging	0.68
R6614:Filip1	UTSW	9	79815839	missense	probably damaging	1.00
R6715:Filip1	UTSW	9	79818758	missense	probably benign	0.03
R7047:Filip1	UTSW	9	79853634	missense	probably damaging	0.98
R7126:Filip1	UTSW	9	79898295	missense	possibly damaging	0.88
R7144:Filip1	UTSW	9	79820213	missense	possibly damaging	0.65
R7218:Filip1	UTSW	9	79818074	missense	probably benign
R7404:Filip1	UTSW	9	79820098	missense	possibly damaging	0.94
R7702:Filip1	UTSW	9	79820649	missense	probably benign	0.20
R7866:Filip1	UTSW	9	79818943	missense	probably benign	0.03
R7933:Filip1	UTSW	9	79820047	missense	possibly damaging	0.65
R8012:Filip1	UTSW	9	79817959	missense	probably damaging	0.97
R8097:Filip1	UTSW	9	79818259	missense	probably benign
R8213:Filip1	UTSW	9	79818092	missense	probably benign	0.01
R8305:Filip1	UTSW	9	79820475	nonsense	probably null
R8798:Filip1	UTSW	9	79820090	missense	possibly damaging	0.94
R9184:Filip1	UTSW	9	79898260	missense	probably benign	0.03
R9322:Filip1	UTSW	9	79819732	missense	probably benign	0.01
R9334:Filip1	UTSW	9	79818457	missense	probably benign	0.32
R9353:Filip1	UTSW	9	79818341	missense	possibly damaging	0.67
R9541:Filip1	UTSW	9	79819853	nonsense	probably null
X0054:Filip1	UTSW	9	79819535	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- GATTTGCGGATGAACACAGC -3'
(R):5'- GGAAATTAAGCACCAAATGGCC -3'

Sequencing Primer
(F):5'- ATGAACACAGCCGGGGTCTC -3'
(R):5'- TTAAGCACCAAATGGCCAAGAAC -3'

Posted On

2022-09-12