Mutagenetix > Incidental Mutation

Incidental Mutation 'R9607:Dsg4'

723971

Institutional Source

Beutler Lab

Gene Symbol

Dsg4

Ensembl Gene

ENSMUSG00000001804

Gene Name

desmoglein 4

Synonyms

lah, CDHF13

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.450) question?

Stock #

R9607 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

20436175-20471821 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 20452990 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Serine at position 246 (T246S)

Ref Sequence

ENSEMBL: ENSMUSP00000019426 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000019426]

AlphaFold

Q7TMD7

Predicted Effect

probably benign
Transcript: ENSMUST00000019426
AA Change: T246S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000019426
Gene: ENSMUSG00000001804
AA Change: T246S

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
CA	70	155	1.54e-11	SMART
CA	179	267	4.27e-19	SMART
CA	290	384	5.48e-8	SMART
CA	411	495	9.4e-7	SMART
transmembrane domain	634	656	N/A	INTRINSIC
low complexity region	724	736	N/A	INTRINSIC
Pfam:Cadherin_C	749	849	3.1e-8	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.7%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of the cadherin family of proteins that forms an integral transmembrane component of desmosomes, the multiprotein complexes involved in cell adhesion, organization of the cytoskeleton, cell sorting and cell signaling. This gene is expressed in the suprabasal epidermis and hair follicle. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. Certain mutations in this gene are responsible for the lanceolate hair phenotype in mice. This gene is located in a cluster of desmosomal cadherin genes on chromosome 18. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice carrying mutations at this locus exhibit abnormalities in hair growth, vibrissae growth, and a thickened epidermis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aak1	T	C	6: 86,937,086		probably null	Het
Atp8a1	T	C	5: 67,659,907	Y927C		Het
BC037034	T	C	5: 138,261,600	D398G	probably damaging	Het
Bckdhb	A	G	9: 83,989,291	I208V	probably benign	Het
Cacna1g	T	C	11: 94,465,888	I141V	probably benign	Het
Celsr1	A	G	15: 86,031,028	S915P		Het
Celsr3	G	A	9: 108,840,502		probably null	Het
Cep295	A	T	9: 15,322,713	D2262E	probably damaging	Het
Chil3	T	C	3: 106,160,369	K160R	probably null	Het
Cmtr1	G	T	17: 29,674,222	A72S	probably benign	Het
Cpa5	T	C	6: 30,626,339	F233S	probably damaging	Het
Creb3l3	G	A	10: 81,084,901	R432W	probably damaging	Het
Csdc2	A	G	15: 81,946,887	D45G	possibly damaging	Het
Csmd3	G	T	15: 47,755,415	T1859K	probably damaging	Het
Cxxc1	T	C	18: 74,220,408		probably null	Het
Dcc	A	G	18: 71,588,001	S430P	probably damaging	Het
Dera	T	G	6: 137,856,734	S270A	unknown	Het
Dnaaf1	A	G	8: 119,582,611	E146G	possibly damaging	Het
Eif4g3	A	G	4: 138,165,734	E766G	probably benign	Het
Ep400	A	C	5: 110,683,939	C2146G	unknown	Het
Epas1	A	T	17: 86,826,610	T516S	probably benign	Het
Espn	A	G	4: 152,135,482	S395P	probably benign	Het
Fam124b	T	A	1: 80,213,096	Q190L	probably damaging	Het
Filip1	T	A	9: 79,819,120	D739V	probably damaging	Het
Flg2	A	G	3: 93,201,412	Y249C	probably damaging	Het
Gm9008	A	T	6: 76,496,940	L231*	probably null	Het
Gon4l	T	A	3: 88,858,444	S391T	probably damaging	Het
Hoxa5	G	T	6: 52,204,216	Y45*	probably null	Het
Ift172	A	G	5: 31,253,569	F1715S		Het
Klhdc9	T	A	1: 171,359,556	H262L	probably damaging	Het
Krt16	C	A	11: 100,247,627	D232Y	probably damaging	Het
Lrrd1	A	G	5: 3,851,561	E622G	probably damaging	Het
Mars	A	T	10: 127,308,624	C182*	probably null	Het
Mcm5	C	T	8: 75,117,540	S313F	probably benign	Het
Msrb2	C	A	2: 19,394,319	N164K	probably damaging	Het
Muc2	T	A	7: 141,751,453	C604S		Het
Mup17	T	C	4: 61,593,666	I124V	probably benign	Het
Myo18b	T	C	5: 112,874,678	M283V	unknown	Het
Ndn	C	T	7: 62,348,589	P61L	possibly damaging	Het
Nepro	T	C	16: 44,731,469	L230P	probably damaging	Het
Nes	A	G	3: 87,976,206	N591D	probably benign	Het
Nfrkb	T	C	9: 31,414,770	S1170P	possibly damaging	Het
Nphs1	A	T	7: 30,463,587	T430S	probably damaging	Het
Nrp1	T	C	8: 128,425,781	V157A	probably benign	Het
Nup188	T	A	2: 30,307,712	D259E	probably benign	Het
Olfr1463	A	T	19: 13,234,589	N113I		Het
Olfr466	G	T	13: 65,153,071	M282I	probably benign	Het
Olfr669	T	C	7: 104,939,000	M158T	probably benign	Het
Olfr905	A	G	9: 38,473,617	Y290C	probably damaging	Het
Park2	A	G	17: 12,004,076	Y371C	probably damaging	Het
Pcdha8	T	A	18: 36,993,164	L233Q	probably damaging	Het
Pcdhga12	T	A	18: 37,768,336	F740L	probably damaging	Het
Pglyrp4	G	A	3: 90,730,844	G155D	probably damaging	Het
Piezo2	G	A	18: 63,386,276		probably benign	Het
Pirb	G	A	7: 3,717,618	R294C	possibly damaging	Het
Ppil1	A	T	17: 29,251,507	*167K	probably null	Het
Prdm10	G	T	9: 31,349,190	D647Y	probably damaging	Het
Prrc2b	T	A	2: 32,208,782	I702N	probably damaging	Het
Rtp4	T	A	16: 23,520,476		probably null	Het
Sema6c	A	G	3: 95,169,234	H277R	probably benign	Het
Slc14a1	C	A	18: 78,109,592	A367S	probably damaging	Het
Slc41a2	A	G	10: 83,283,767	L377P	probably damaging	Het
Soga1	T	G	2: 157,027,568	E1049A	probably damaging	Het
Svil	T	C	18: 5,058,126	Y630H	possibly damaging	Het
Tbata	A	G	10: 61,175,847	H54R	probably benign	Het
Tnfaip2	C	A	12: 111,445,635	Q157K	possibly damaging	Het
Ttn	C	T	2: 76,885,013	E7912K	unknown	Het
Vmn2r74	T	A	7: 85,961,411	R24S	probably benign	Het
Vmn2r90	G	A	17: 17,733,376	V601M	possibly damaging	Het
Vmn2r-ps117	A	G	17: 18,823,678	T339A	probably benign	Het
Xirp2	C	T	2: 67,510,762	H1116Y	possibly damaging	Het
Xrcc1	A	G	7: 24,566,265	D156G	probably benign	Het

Other mutations in Dsg4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00708:Dsg4	APN	18	20461326	missense	probably benign	0.22
IGL01723:Dsg4	APN	18	20466510	missense	probably damaging	1.00
IGL02249:Dsg4	APN	18	20461304	missense	possibly damaging	0.69
IGL02445:Dsg4	APN	18	20446250	splice site	probably benign
IGL02553:Dsg4	APN	18	20462520	missense	probably benign
IGL02578:Dsg4	APN	18	20471193	missense	possibly damaging	0.94
IGL02634:Dsg4	APN	18	20458580	missense	probably benign	0.01
IGL02677:Dsg4	APN	18	20464876	missense	possibly damaging	0.62
IGL02741:Dsg4	APN	18	20471496	missense	probably benign
IGL02747:Dsg4	APN	18	20446938	missense	probably damaging	0.97
IGL03342:Dsg4	APN	18	20451823	missense	probably damaging	1.00
burrito	UTSW	18	20451862	missense	possibly damaging	0.81
woodshed	UTSW	18	20451872	nonsense	probably null
R0043:Dsg4	UTSW	18	20452972	missense	probably damaging	1.00
R0375:Dsg4	UTSW	18	20470879	missense	probably damaging	1.00
R0537:Dsg4	UTSW	18	20458571	missense	probably damaging	1.00
R0619:Dsg4	UTSW	18	20461359	missense	probably benign	0.00
R0622:Dsg4	UTSW	18	20449788	missense	possibly damaging	0.51
R0765:Dsg4	UTSW	18	20454646	splice site	probably benign
R0786:Dsg4	UTSW	18	20449372	critical splice donor site	probably null
R1114:Dsg4	UTSW	18	20466483	missense	possibly damaging	0.62
R1249:Dsg4	UTSW	18	20446872	nonsense	probably null
R1372:Dsg4	UTSW	18	20449676	splice site	probably null
R1382:Dsg4	UTSW	18	20465124	missense	probably benign	0.00
R1392:Dsg4	UTSW	18	20446247	splice site	probably benign
R1442:Dsg4	UTSW	18	20462660	missense	possibly damaging	0.76
R1503:Dsg4	UTSW	18	20449679	missense	probably damaging	1.00
R1704:Dsg4	UTSW	18	20471589	missense	probably damaging	1.00
R1716:Dsg4	UTSW	18	20462461	nonsense	probably null
R1765:Dsg4	UTSW	18	20456831	missense	probably benign	0.01
R1817:Dsg4	UTSW	18	20471245	missense	probably damaging	1.00
R1982:Dsg4	UTSW	18	20471212	missense	probably damaging	1.00
R2025:Dsg4	UTSW	18	20466636	nonsense	probably null
R2097:Dsg4	UTSW	18	20471044	missense	probably damaging	1.00
R2198:Dsg4	UTSW	18	20461442	missense	probably benign
R3551:Dsg4	UTSW	18	20451756	missense	probably damaging	1.00
R3742:Dsg4	UTSW	18	20471001	missense	probably damaging	1.00
R3853:Dsg4	UTSW	18	20449234	missense	probably benign
R3955:Dsg4	UTSW	18	20449375	splice site	probably null
R4006:Dsg4	UTSW	18	20470965	missense	probably damaging	0.97
R4012:Dsg4	UTSW	18	20451862	missense	possibly damaging	0.81
R4171:Dsg4	UTSW	18	20458579	nonsense	probably null
R4254:Dsg4	UTSW	18	20471538	missense	probably benign	0.07
R4504:Dsg4	UTSW	18	20461436	missense	probably benign	0.00
R4559:Dsg4	UTSW	18	20470921	missense	probably damaging	1.00
R4607:Dsg4	UTSW	18	20471245	missense	probably damaging	1.00
R4612:Dsg4	UTSW	18	20462413	missense	probably benign	0.10
R4683:Dsg4	UTSW	18	20461409	missense	probably benign
R4700:Dsg4	UTSW	18	20456908	missense	possibly damaging	0.91
R4749:Dsg4	UTSW	18	20446831	missense	possibly damaging	0.88
R4775:Dsg4	UTSW	18	20471127	missense	possibly damaging	0.48
R4809:Dsg4	UTSW	18	20466621	missense	possibly damaging	0.82
R5276:Dsg4	UTSW	18	20446839	missense	probably benign	0.21
R5426:Dsg4	UTSW	18	20458484	missense	probably damaging	1.00
R5767:Dsg4	UTSW	18	20462492	nonsense	probably null
R5982:Dsg4	UTSW	18	20465169	missense	possibly damaging	0.76
R6280:Dsg4	UTSW	18	20466667	missense	probably damaging	1.00
R6305:Dsg4	UTSW	18	20449790	missense	probably damaging	1.00
R6489:Dsg4	UTSW	18	20471363	missense	possibly damaging	0.93
R7013:Dsg4	UTSW	18	20458521	missense	possibly damaging	0.58
R7040:Dsg4	UTSW	18	20451852	missense	probably benign	0.01
R7196:Dsg4	UTSW	18	20466480	missense	probably damaging	1.00
R7432:Dsg4	UTSW	18	20446266	nonsense	probably null
R7438:Dsg4	UTSW	18	20466628	missense	probably damaging	0.96
R7490:Dsg4	UTSW	18	20451936	splice site	probably null
R7612:Dsg4	UTSW	18	20470990	missense	probably damaging	1.00
R7639:Dsg4	UTSW	18	20449712	missense	probably damaging	1.00
R7905:Dsg4	UTSW	18	20454669	missense	probably damaging	1.00
R8251:Dsg4	UTSW	18	20471164	missense	probably damaging	1.00
R8326:Dsg4	UTSW	18	20449731	missense	probably benign	0.31
R8554:Dsg4	UTSW	18	20453043	missense	probably damaging	1.00
R8911:Dsg4	UTSW	18	20451872	nonsense	probably null
R9059:Dsg4	UTSW	18	20471125	missense	possibly damaging	0.62
R9508:Dsg4	UTSW	18	20471013	missense	probably damaging	1.00
R9765:Dsg4	UTSW	18	20471277	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- CAAGACAGGAATTCAATCAGGTCAG -3'
(R):5'- AATAAAGCTGAGTTCTTCCACGC -3'

Sequencing Primer
(F):5'- TTCAATCAGGTCAGGAAGTAGG -3'
(R):5'- GCTATAACAGCCAGGCTTCTG -3'

Posted On

2022-09-12