Incidental Mutation 'R9607:Dsg4'
ID 723971
Institutional Source Beutler Lab
Gene Symbol Dsg4
Ensembl Gene ENSMUSG00000001804
Gene Name desmoglein 4
Synonyms lah, CDHF13
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.450) question?
Stock # R9607 (G1)
Quality Score 225.009
Status Not validated
Chromosome 18
Chromosomal Location 20436175-20471821 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 20452990 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 246 (T246S)
Ref Sequence ENSEMBL: ENSMUSP00000019426 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019426]
AlphaFold Q7TMD7
Predicted Effect probably benign
Transcript: ENSMUST00000019426
AA Change: T246S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000019426
Gene: ENSMUSG00000001804
AA Change: T246S

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
CA 70 155 1.54e-11 SMART
CA 179 267 4.27e-19 SMART
CA 290 384 5.48e-8 SMART
CA 411 495 9.4e-7 SMART
transmembrane domain 634 656 N/A INTRINSIC
low complexity region 724 736 N/A INTRINSIC
Pfam:Cadherin_C 749 849 3.1e-8 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of proteins that forms an integral transmembrane component of desmosomes, the multiprotein complexes involved in cell adhesion, organization of the cytoskeleton, cell sorting and cell signaling. This gene is expressed in the suprabasal epidermis and hair follicle. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. Certain mutations in this gene are responsible for the lanceolate hair phenotype in mice. This gene is located in a cluster of desmosomal cadherin genes on chromosome 18. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice carrying mutations at this locus exhibit abnormalities in hair growth, vibrissae growth, and a thickened epidermis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aak1 T C 6: 86,937,086 probably null Het
Atp8a1 T C 5: 67,659,907 Y927C Het
BC037034 T C 5: 138,261,600 D398G probably damaging Het
Bckdhb A G 9: 83,989,291 I208V probably benign Het
Cacna1g T C 11: 94,465,888 I141V probably benign Het
Celsr1 A G 15: 86,031,028 S915P Het
Celsr3 G A 9: 108,840,502 probably null Het
Cep295 A T 9: 15,322,713 D2262E probably damaging Het
Chil3 T C 3: 106,160,369 K160R probably null Het
Cmtr1 G T 17: 29,674,222 A72S probably benign Het
Cpa5 T C 6: 30,626,339 F233S probably damaging Het
Creb3l3 G A 10: 81,084,901 R432W probably damaging Het
Csdc2 A G 15: 81,946,887 D45G possibly damaging Het
Csmd3 G T 15: 47,755,415 T1859K probably damaging Het
Cxxc1 T C 18: 74,220,408 probably null Het
Dcc A G 18: 71,588,001 S430P probably damaging Het
Dera T G 6: 137,856,734 S270A unknown Het
Dnaaf1 A G 8: 119,582,611 E146G possibly damaging Het
Eif4g3 A G 4: 138,165,734 E766G probably benign Het
Ep400 A C 5: 110,683,939 C2146G unknown Het
Epas1 A T 17: 86,826,610 T516S probably benign Het
Espn A G 4: 152,135,482 S395P probably benign Het
Fam124b T A 1: 80,213,096 Q190L probably damaging Het
Filip1 T A 9: 79,819,120 D739V probably damaging Het
Flg2 A G 3: 93,201,412 Y249C probably damaging Het
Gm9008 A T 6: 76,496,940 L231* probably null Het
Gon4l T A 3: 88,858,444 S391T probably damaging Het
Hoxa5 G T 6: 52,204,216 Y45* probably null Het
Ift172 A G 5: 31,253,569 F1715S Het
Klhdc9 T A 1: 171,359,556 H262L probably damaging Het
Krt16 C A 11: 100,247,627 D232Y probably damaging Het
Lrrd1 A G 5: 3,851,561 E622G probably damaging Het
Mars A T 10: 127,308,624 C182* probably null Het
Mcm5 C T 8: 75,117,540 S313F probably benign Het
Msrb2 C A 2: 19,394,319 N164K probably damaging Het
Muc2 T A 7: 141,751,453 C604S Het
Mup17 T C 4: 61,593,666 I124V probably benign Het
Myo18b T C 5: 112,874,678 M283V unknown Het
Ndn C T 7: 62,348,589 P61L possibly damaging Het
Nepro T C 16: 44,731,469 L230P probably damaging Het
Nes A G 3: 87,976,206 N591D probably benign Het
Nfrkb T C 9: 31,414,770 S1170P possibly damaging Het
Nphs1 A T 7: 30,463,587 T430S probably damaging Het
Nrp1 T C 8: 128,425,781 V157A probably benign Het
Nup188 T A 2: 30,307,712 D259E probably benign Het
Olfr1463 A T 19: 13,234,589 N113I Het
Olfr466 G T 13: 65,153,071 M282I probably benign Het
Olfr669 T C 7: 104,939,000 M158T probably benign Het
Olfr905 A G 9: 38,473,617 Y290C probably damaging Het
Park2 A G 17: 12,004,076 Y371C probably damaging Het
Pcdha8 T A 18: 36,993,164 L233Q probably damaging Het
Pcdhga12 T A 18: 37,768,336 F740L probably damaging Het
Pglyrp4 G A 3: 90,730,844 G155D probably damaging Het
Piezo2 G A 18: 63,386,276 probably benign Het
Pirb G A 7: 3,717,618 R294C possibly damaging Het
Ppil1 A T 17: 29,251,507 *167K probably null Het
Prdm10 G T 9: 31,349,190 D647Y probably damaging Het
Prrc2b T A 2: 32,208,782 I702N probably damaging Het
Rtp4 T A 16: 23,520,476 probably null Het
Sema6c A G 3: 95,169,234 H277R probably benign Het
Slc14a1 C A 18: 78,109,592 A367S probably damaging Het
Slc41a2 A G 10: 83,283,767 L377P probably damaging Het
Soga1 T G 2: 157,027,568 E1049A probably damaging Het
Svil T C 18: 5,058,126 Y630H possibly damaging Het
Tbata A G 10: 61,175,847 H54R probably benign Het
Tnfaip2 C A 12: 111,445,635 Q157K possibly damaging Het
Ttn C T 2: 76,885,013 E7912K unknown Het
Vmn2r74 T A 7: 85,961,411 R24S probably benign Het
Vmn2r90 G A 17: 17,733,376 V601M possibly damaging Het
Vmn2r-ps117 A G 17: 18,823,678 T339A probably benign Het
Xirp2 C T 2: 67,510,762 H1116Y possibly damaging Het
Xrcc1 A G 7: 24,566,265 D156G probably benign Het
Other mutations in Dsg4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00708:Dsg4 APN 18 20461326 missense probably benign 0.22
IGL01723:Dsg4 APN 18 20466510 missense probably damaging 1.00
IGL02249:Dsg4 APN 18 20461304 missense possibly damaging 0.69
IGL02445:Dsg4 APN 18 20446250 splice site probably benign
IGL02553:Dsg4 APN 18 20462520 missense probably benign
IGL02578:Dsg4 APN 18 20471193 missense possibly damaging 0.94
IGL02634:Dsg4 APN 18 20458580 missense probably benign 0.01
IGL02677:Dsg4 APN 18 20464876 missense possibly damaging 0.62
IGL02741:Dsg4 APN 18 20471496 missense probably benign
IGL02747:Dsg4 APN 18 20446938 missense probably damaging 0.97
IGL03342:Dsg4 APN 18 20451823 missense probably damaging 1.00
burrito UTSW 18 20451862 missense possibly damaging 0.81
woodshed UTSW 18 20451872 nonsense probably null
R0043:Dsg4 UTSW 18 20452972 missense probably damaging 1.00
R0375:Dsg4 UTSW 18 20470879 missense probably damaging 1.00
R0537:Dsg4 UTSW 18 20458571 missense probably damaging 1.00
R0619:Dsg4 UTSW 18 20461359 missense probably benign 0.00
R0622:Dsg4 UTSW 18 20449788 missense possibly damaging 0.51
R0765:Dsg4 UTSW 18 20454646 splice site probably benign
R0786:Dsg4 UTSW 18 20449372 critical splice donor site probably null
R1114:Dsg4 UTSW 18 20466483 missense possibly damaging 0.62
R1249:Dsg4 UTSW 18 20446872 nonsense probably null
R1372:Dsg4 UTSW 18 20449676 splice site probably null
R1382:Dsg4 UTSW 18 20465124 missense probably benign 0.00
R1392:Dsg4 UTSW 18 20446247 splice site probably benign
R1442:Dsg4 UTSW 18 20462660 missense possibly damaging 0.76
R1503:Dsg4 UTSW 18 20449679 missense probably damaging 1.00
R1704:Dsg4 UTSW 18 20471589 missense probably damaging 1.00
R1716:Dsg4 UTSW 18 20462461 nonsense probably null
R1765:Dsg4 UTSW 18 20456831 missense probably benign 0.01
R1817:Dsg4 UTSW 18 20471245 missense probably damaging 1.00
R1982:Dsg4 UTSW 18 20471212 missense probably damaging 1.00
R2025:Dsg4 UTSW 18 20466636 nonsense probably null
R2097:Dsg4 UTSW 18 20471044 missense probably damaging 1.00
R2198:Dsg4 UTSW 18 20461442 missense probably benign
R3551:Dsg4 UTSW 18 20451756 missense probably damaging 1.00
R3742:Dsg4 UTSW 18 20471001 missense probably damaging 1.00
R3853:Dsg4 UTSW 18 20449234 missense probably benign
R3955:Dsg4 UTSW 18 20449375 splice site probably null
R4006:Dsg4 UTSW 18 20470965 missense probably damaging 0.97
R4012:Dsg4 UTSW 18 20451862 missense possibly damaging 0.81
R4171:Dsg4 UTSW 18 20458579 nonsense probably null
R4254:Dsg4 UTSW 18 20471538 missense probably benign 0.07
R4504:Dsg4 UTSW 18 20461436 missense probably benign 0.00
R4559:Dsg4 UTSW 18 20470921 missense probably damaging 1.00
R4607:Dsg4 UTSW 18 20471245 missense probably damaging 1.00
R4612:Dsg4 UTSW 18 20462413 missense probably benign 0.10
R4683:Dsg4 UTSW 18 20461409 missense probably benign
R4700:Dsg4 UTSW 18 20456908 missense possibly damaging 0.91
R4749:Dsg4 UTSW 18 20446831 missense possibly damaging 0.88
R4775:Dsg4 UTSW 18 20471127 missense possibly damaging 0.48
R4809:Dsg4 UTSW 18 20466621 missense possibly damaging 0.82
R5276:Dsg4 UTSW 18 20446839 missense probably benign 0.21
R5426:Dsg4 UTSW 18 20458484 missense probably damaging 1.00
R5767:Dsg4 UTSW 18 20462492 nonsense probably null
R5982:Dsg4 UTSW 18 20465169 missense possibly damaging 0.76
R6280:Dsg4 UTSW 18 20466667 missense probably damaging 1.00
R6305:Dsg4 UTSW 18 20449790 missense probably damaging 1.00
R6489:Dsg4 UTSW 18 20471363 missense possibly damaging 0.93
R7013:Dsg4 UTSW 18 20458521 missense possibly damaging 0.58
R7040:Dsg4 UTSW 18 20451852 missense probably benign 0.01
R7196:Dsg4 UTSW 18 20466480 missense probably damaging 1.00
R7432:Dsg4 UTSW 18 20446266 nonsense probably null
R7438:Dsg4 UTSW 18 20466628 missense probably damaging 0.96
R7490:Dsg4 UTSW 18 20451936 splice site probably null
R7612:Dsg4 UTSW 18 20470990 missense probably damaging 1.00
R7639:Dsg4 UTSW 18 20449712 missense probably damaging 1.00
R7905:Dsg4 UTSW 18 20454669 missense probably damaging 1.00
R8251:Dsg4 UTSW 18 20471164 missense probably damaging 1.00
R8326:Dsg4 UTSW 18 20449731 missense probably benign 0.31
R8554:Dsg4 UTSW 18 20453043 missense probably damaging 1.00
R8911:Dsg4 UTSW 18 20451872 nonsense probably null
R9059:Dsg4 UTSW 18 20471125 missense possibly damaging 0.62
R9508:Dsg4 UTSW 18 20471013 missense probably damaging 1.00
R9765:Dsg4 UTSW 18 20471277 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CAAGACAGGAATTCAATCAGGTCAG -3'
(R):5'- AATAAAGCTGAGTTCTTCCACGC -3'

Sequencing Primer
(F):5'- TTCAATCAGGTCAGGAAGTAGG -3'
(R):5'- GCTATAACAGCCAGGCTTCTG -3'
Posted On 2022-09-12