Incidental Mutation 'R9608:Smarcad1'
ID 724005
Institutional Source Beutler Lab
Gene Symbol Smarcad1
Ensembl Gene ENSMUSG00000029920
Gene Name SWI/SNF-related, matrix-associated actin-dependent regulator of chromatin, subfamily a, containing DEAD/H box 1
Synonyms Etl1, D6Pas1
MMRRC Submission
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.303) question?
Stock # R9608 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 65019577-65093045 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 65091318 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 1013 (T1013I)
Ref Sequence ENSEMBL: ENSMUSP00000031984 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031982] [ENSMUST00000031984] [ENSMUST00000204620]
AlphaFold Q04692
Predicted Effect probably benign
Transcript: ENSMUST00000031982
SMART Domains Protein: ENSMUSP00000031982
Gene: ENSMUSG00000029919

DomainStartEndE-ValueType
Pfam:GST_N 4 73 2.8e-13 PFAM
Pfam:GST_N_3 14 79 2.9e-7 PFAM
Pfam:GST_C 91 185 3.1e-6 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000031984
AA Change: T1013I

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000031984
Gene: ENSMUSG00000029920
AA Change: T1013I

DomainStartEndE-ValueType
low complexity region 17 37 N/A INTRINSIC
low complexity region 39 53 N/A INTRINSIC
low complexity region 143 156 N/A INTRINSIC
low complexity region 210 224 N/A INTRINSIC
low complexity region 233 244 N/A INTRINSIC
low complexity region 333 348 N/A INTRINSIC
DEXDc 488 682 2.58e-38 SMART
Blast:DEXDc 685 745 4e-16 BLAST
HELICc 879 962 4.58e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000204620
SMART Domains Protein: ENSMUSP00000144767
Gene: ENSMUSG00000029920

DomainStartEndE-ValueType
low complexity region 17 37 N/A INTRINSIC
low complexity region 39 53 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SNF subfamily of helicase proteins. The encoded protein plays a critical role in the restoration of heterochromatin organization and propagation of epigenetic patterns following DNA replication by mediating histone H3/H4 deacetylation. Mutations in this gene are associated with adermatoglyphia. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit retarded growth, impaired fertility, skeletal dysplasias, and peri- and postnatal lethality. Mutant phenotypes are influenced by genetic background. [provided by MGI curators]
Allele List at MGI

All alleles(258) : Targeted, knock-out(1) Targeted, other(1) Gene trapped(256)

Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl5 T A 19: 55,272,884 (GRCm39) I333N probably damaging Het
Adam2 T C 14: 66,291,279 (GRCm39) N333S probably null Het
Adgrb2 A G 4: 129,907,352 (GRCm39) T955A probably damaging Het
Agxt2 T C 15: 10,400,624 (GRCm39) F476S possibly damaging Het
Asb14 T A 14: 26,634,148 (GRCm39) F451Y probably damaging Het
Atg9a A T 1: 75,161,739 (GRCm39) N602K possibly damaging Het
Atp2a3 T C 11: 72,879,866 (GRCm39) I978T probably benign Het
BC034090 A G 1: 155,099,135 (GRCm39) V550A possibly damaging Het
Bud23 T A 5: 135,086,526 (GRCm39) probably null Het
C1qtnf3 A T 15: 10,952,568 (GRCm39) H10L probably benign Het
Cage1 G C 13: 38,195,371 (GRCm39) I783M possibly damaging Het
Ccdc142 C T 6: 83,084,082 (GRCm39) Q496* probably null Het
Cd163 A C 6: 124,286,163 (GRCm39) K238Q possibly damaging Het
Cdh6 A T 15: 13,064,621 (GRCm39) Y90N probably damaging Het
Cpeb1 A G 7: 81,021,758 (GRCm39) probably null Het
Cpt2 G T 4: 107,765,341 (GRCm39) P141Q probably damaging Het
Cspg4 T A 9: 56,792,836 (GRCm39) H190Q probably benign Het
Dcst1 T C 3: 89,266,442 (GRCm39) M139V possibly damaging Het
Dennd5a G C 7: 109,520,713 (GRCm39) N381K probably damaging Het
Dera A G 6: 137,813,876 (GRCm39) R299G possibly damaging Het
Dnah2 C T 11: 69,344,888 (GRCm39) G2729R probably null Het
Dnajc11 A G 4: 152,034,978 (GRCm39) E67G possibly damaging Het
Eif2ak3 T A 6: 70,841,511 (GRCm39) C152* probably null Het
Eln T G 5: 134,755,331 (GRCm39) K241Q unknown Het
Exoc6b C T 6: 84,602,106 (GRCm39) probably null Het
Eya1 A T 1: 14,373,029 (GRCm39) I30K probably benign Het
Fbxo39 A G 11: 72,208,101 (GRCm39) K151R probably benign Het
Fer A G 17: 64,214,327 (GRCm39) T87A probably benign Het
Fgf4 A T 7: 144,415,335 (GRCm39) N32Y possibly damaging Het
Fkbp6 G A 5: 135,375,027 (GRCm39) P129S probably damaging Het
Fndc7 C A 3: 108,774,597 (GRCm39) V554F probably damaging Het
Frk G A 10: 34,481,873 (GRCm39) probably null Het
Ghrhr T A 6: 55,357,786 (GRCm39) I139N possibly damaging Het
Gm17175 A T 14: 51,809,099 (GRCm39) M89K probably damaging Het
Gm4787 A T 12: 81,425,086 (GRCm39) N357K probably benign Het
Gpihbp1 G A 15: 75,469,612 (GRCm39) C109Y probably damaging Het
Gps1 T C 11: 120,677,641 (GRCm39) V257A probably benign Het
H2-M3 T C 17: 37,581,159 (GRCm39) S3P probably benign Het
Hmcn1 G A 1: 150,475,303 (GRCm39) P4674L probably damaging Het
Hoxa11 T C 6: 52,222,224 (GRCm39) D159G probably benign Het
Kcnn4 G A 7: 24,083,503 (GRCm39) D395N probably damaging Het
Krt222 T C 11: 99,126,981 (GRCm39) E213G probably damaging Het
Lmcd1 A G 6: 112,306,785 (GRCm39) D319G possibly damaging Het
Ltv1 A G 10: 13,066,440 (GRCm39) F62S probably damaging Het
Man2a1 G T 17: 65,041,953 (GRCm39) R957L probably damaging Het
Mcm5 C T 8: 75,844,168 (GRCm39) S313F probably benign Het
Mrpl45 T G 11: 97,217,687 (GRCm39) V197G probably damaging Het
Ndn C T 7: 61,998,337 (GRCm39) P61L possibly damaging Het
Nek4 T C 14: 30,675,904 (GRCm39) Y73H probably damaging Het
Nom1 T A 5: 29,642,750 (GRCm39) V417D probably damaging Het
Or10q1b A T 19: 13,682,868 (GRCm39) I226F probably damaging Het
Or4k5 A G 14: 50,386,055 (GRCm39) I92T probably benign Het
Or5p68 A G 7: 107,945,513 (GRCm39) L225P probably damaging Het
Pacs1 A G 19: 5,193,862 (GRCm39) S556P probably damaging Het
Pcdh1 C T 18: 38,330,904 (GRCm39) V839M possibly damaging Het
Pcdhb18 T A 18: 37,623,694 (GRCm39) N341K probably damaging Het
Pde6d G A 1: 86,473,424 (GRCm39) T124M possibly damaging Het
Piezo2 T A 18: 63,280,016 (GRCm39) E185V probably benign Het
Pkhd1l1 T C 15: 44,442,029 (GRCm39) V3656A possibly damaging Het
Plcg1 A G 2: 160,597,671 (GRCm39) Y771C probably benign Het
Ppdpf T C 2: 180,829,668 (GRCm39) L41P probably benign Het
Prepl T C 17: 85,376,321 (GRCm39) T578A probably benign Het
Prkdc T A 16: 15,548,335 (GRCm39) L1981Q probably damaging Het
Prkdc C A 16: 15,548,334 (GRCm39) L1981M possibly damaging Het
Rb1cc1 C T 1: 6,318,528 (GRCm39) S649L probably benign Het
Rbbp6 A G 7: 122,591,268 (GRCm39) T457A possibly damaging Het
Sbf1 T A 15: 89,191,808 (GRCm39) probably null Het
Scn1a T C 2: 66,152,687 (GRCm39) I776V probably benign Het
Sec23a G A 12: 59,019,804 (GRCm39) P588S probably benign Het
Slfn5 A G 11: 82,851,830 (GRCm39) D652G possibly damaging Het
Slfn5 C A 11: 82,852,321 (GRCm39) P816T probably benign Het
Spidr G A 16: 15,855,474 (GRCm39) T347I probably benign Het
Stx1b A T 7: 127,406,551 (GRCm39) M266K probably damaging Het
Tarm1 A G 7: 3,551,062 (GRCm39) probably benign Het
Tfap2c A T 2: 172,391,764 (GRCm39) K4* probably null Het
Trpm5 A T 7: 142,633,148 (GRCm39) V819E possibly damaging Het
Trrap A G 5: 144,780,128 (GRCm39) T3240A possibly damaging Het
Uqcc2 A T 17: 27,341,709 (GRCm39) V130D probably benign Het
Uspl1 T A 5: 149,151,870 (GRCm39) D1023E probably benign Het
Vinac1 C T 2: 128,878,550 (GRCm39) W1125* probably null Het
Vmn2r28 A T 7: 5,491,220 (GRCm39) H342Q probably benign Het
Vmn2r33 A T 7: 7,557,153 (GRCm39) C516S possibly damaging Het
Vps45 G A 3: 95,940,982 (GRCm39) R420W probably damaging Het
Zfp42 C T 8: 43,749,172 (GRCm39) V110I possibly damaging Het
Zfp467 T A 6: 48,404,776 (GRCm39) K100N unknown Het
Zfyve16 A T 13: 92,636,788 (GRCm39) S1307R probably damaging Het
Other mutations in Smarcad1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02318:Smarcad1 APN 6 65,050,223 (GRCm39) missense probably damaging 1.00
IGL02707:Smarcad1 APN 6 65,029,790 (GRCm39) unclassified probably benign
IGL03006:Smarcad1 APN 6 65,060,873 (GRCm39) missense probably benign 0.01
IGL03131:Smarcad1 APN 6 65,051,937 (GRCm39) missense probably damaging 0.96
IGL03406:Smarcad1 APN 6 65,069,510 (GRCm39) missense probably damaging 0.98
Trollip UTSW 6 65,091,320 (GRCm39) missense probably damaging 1.00
wastrel UTSW 6 65,029,654 (GRCm39) missense probably damaging 1.00
N/A - 293:Smarcad1 UTSW 6 65,051,898 (GRCm39) missense probably benign 0.06
R0020:Smarcad1 UTSW 6 65,060,991 (GRCm39) splice site probably benign
R0452:Smarcad1 UTSW 6 65,051,806 (GRCm39) missense possibly damaging 0.66
R1005:Smarcad1 UTSW 6 65,085,711 (GRCm39) missense probably benign 0.30
R1143:Smarcad1 UTSW 6 65,073,678 (GRCm39) missense probably benign 0.02
R1624:Smarcad1 UTSW 6 65,029,631 (GRCm39) missense probably benign 0.40
R1629:Smarcad1 UTSW 6 65,044,091 (GRCm39) missense probably benign 0.00
R1705:Smarcad1 UTSW 6 65,033,400 (GRCm39) missense probably damaging 1.00
R2000:Smarcad1 UTSW 6 65,050,200 (GRCm39) missense probably damaging 1.00
R2979:Smarcad1 UTSW 6 65,051,995 (GRCm39) missense probably benign 0.00
R3937:Smarcad1 UTSW 6 65,091,320 (GRCm39) missense probably damaging 1.00
R4391:Smarcad1 UTSW 6 65,033,443 (GRCm39) missense probably benign 0.17
R4648:Smarcad1 UTSW 6 65,044,073 (GRCm39) missense probably benign 0.04
R4697:Smarcad1 UTSW 6 65,029,625 (GRCm39) missense probably benign 0.00
R4709:Smarcad1 UTSW 6 65,052,099 (GRCm39) missense probably benign 0.01
R4726:Smarcad1 UTSW 6 65,052,025 (GRCm39) missense probably damaging 1.00
R4776:Smarcad1 UTSW 6 65,075,808 (GRCm39) missense probably null 1.00
R4928:Smarcad1 UTSW 6 65,051,898 (GRCm39) missense probably benign 0.06
R5619:Smarcad1 UTSW 6 65,088,865 (GRCm39) missense probably benign 0.03
R5709:Smarcad1 UTSW 6 65,051,746 (GRCm39) missense probably benign 0.01
R6038:Smarcad1 UTSW 6 65,050,232 (GRCm39) missense possibly damaging 0.91
R6038:Smarcad1 UTSW 6 65,050,232 (GRCm39) missense possibly damaging 0.91
R6220:Smarcad1 UTSW 6 65,091,313 (GRCm39) missense probably benign 0.09
R6302:Smarcad1 UTSW 6 65,052,122 (GRCm39) missense possibly damaging 0.93
R7014:Smarcad1 UTSW 6 65,029,654 (GRCm39) missense probably damaging 1.00
R7149:Smarcad1 UTSW 6 65,029,716 (GRCm39) missense probably benign 0.11
R7378:Smarcad1 UTSW 6 65,087,360 (GRCm39) missense probably benign 0.16
R7569:Smarcad1 UTSW 6 65,029,695 (GRCm39) missense probably benign 0.11
R7626:Smarcad1 UTSW 6 65,073,033 (GRCm39) missense possibly damaging 0.71
R7774:Smarcad1 UTSW 6 65,084,814 (GRCm39) missense probably damaging 1.00
R8079:Smarcad1 UTSW 6 65,029,766 (GRCm39) missense possibly damaging 0.51
R8119:Smarcad1 UTSW 6 65,071,303 (GRCm39) missense probably benign
R8129:Smarcad1 UTSW 6 65,044,078 (GRCm39) missense probably benign 0.09
R8558:Smarcad1 UTSW 6 65,060,908 (GRCm39) missense probably benign 0.09
R8679:Smarcad1 UTSW 6 65,088,865 (GRCm39) missense probably benign 0.03
R8770:Smarcad1 UTSW 6 65,029,718 (GRCm39) missense probably benign
R8795:Smarcad1 UTSW 6 65,049,033 (GRCm39) missense probably benign 0.10
R9104:Smarcad1 UTSW 6 65,075,649 (GRCm39) missense probably benign 0.06
R9133:Smarcad1 UTSW 6 65,049,035 (GRCm39) missense probably damaging 0.99
R9400:Smarcad1 UTSW 6 65,050,214 (GRCm39) missense probably damaging 0.97
R9401:Smarcad1 UTSW 6 65,071,321 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TAACTCAGCTGTATAGGTTAGGTCAG -3'
(R):5'- GATGTGAGGATCTGGAGAATCC -3'

Sequencing Primer
(F):5'- GGTCAGGTTTTTAATGAGATGACACC -3'
(R):5'- CCAGTTAGTGGCAAAAAGTTGTCC -3'
Posted On 2022-09-12