Incidental Mutation 'R9608:Gm4787'
ID 724038
Institutional Source Beutler Lab
Gene Symbol Gm4787
Ensembl Gene ENSMUSG00000072974
Gene Name predicted gene 4787
Synonyms
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.058) question?
Stock # R9608 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 81423765-81426238 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 81425086 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 357 (N357K)
Ref Sequence ENSEMBL: ENSMUSP00000077390 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062182] [ENSMUST00000110340] [ENSMUST00000164386] [ENSMUST00000166723]
AlphaFold B2RUD9
Predicted Effect probably benign
Transcript: ENSMUST00000062182
AA Change: N357K

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000077390
Gene: ENSMUSG00000072974
AA Change: N357K

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
Pfam:Pep_M12B_propep 46 163 1.5e-19 PFAM
Pfam:Reprolysin 213 406 4.6e-18 PFAM
DISIN 425 500 2e-33 SMART
ACR 501 644 2.83e-53 SMART
transmembrane domain 714 736 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110340
SMART Domains Protein: ENSMUSP00000105969
Gene: ENSMUSG00000091803

DomainStartEndE-ValueType
Pfam:COX16 16 74 6.6e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164386
SMART Domains Protein: ENSMUSP00000132941
Gene: ENSMUSG00000021139

DomainStartEndE-ValueType
PDZ 21 100 6.16e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166723
SMART Domains Protein: ENSMUSP00000130935
Gene: ENSMUSG00000091803

DomainStartEndE-ValueType
Pfam:COX16 16 73 6.9e-16 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl5 T A 19: 55,272,884 (GRCm39) I333N probably damaging Het
Adam2 T C 14: 66,291,279 (GRCm39) N333S probably null Het
Adgrb2 A G 4: 129,907,352 (GRCm39) T955A probably damaging Het
Agxt2 T C 15: 10,400,624 (GRCm39) F476S possibly damaging Het
Asb14 T A 14: 26,634,148 (GRCm39) F451Y probably damaging Het
Atg9a A T 1: 75,161,739 (GRCm39) N602K possibly damaging Het
Atp2a3 T C 11: 72,879,866 (GRCm39) I978T probably benign Het
BC034090 A G 1: 155,099,135 (GRCm39) V550A possibly damaging Het
Bud23 T A 5: 135,086,526 (GRCm39) probably null Het
C1qtnf3 A T 15: 10,952,568 (GRCm39) H10L probably benign Het
Cage1 G C 13: 38,195,371 (GRCm39) I783M possibly damaging Het
Ccdc142 C T 6: 83,084,082 (GRCm39) Q496* probably null Het
Cd163 A C 6: 124,286,163 (GRCm39) K238Q possibly damaging Het
Cdh6 A T 15: 13,064,621 (GRCm39) Y90N probably damaging Het
Cpeb1 A G 7: 81,021,758 (GRCm39) probably null Het
Cpt2 G T 4: 107,765,341 (GRCm39) P141Q probably damaging Het
Cspg4 T A 9: 56,792,836 (GRCm39) H190Q probably benign Het
Dcst1 T C 3: 89,266,442 (GRCm39) M139V possibly damaging Het
Dennd5a G C 7: 109,520,713 (GRCm39) N381K probably damaging Het
Dera A G 6: 137,813,876 (GRCm39) R299G possibly damaging Het
Dnah2 C T 11: 69,344,888 (GRCm39) G2729R probably null Het
Dnajc11 A G 4: 152,034,978 (GRCm39) E67G possibly damaging Het
Eif2ak3 T A 6: 70,841,511 (GRCm39) C152* probably null Het
Eln T G 5: 134,755,331 (GRCm39) K241Q unknown Het
Exoc6b C T 6: 84,602,106 (GRCm39) probably null Het
Eya1 A T 1: 14,373,029 (GRCm39) I30K probably benign Het
Fbxo39 A G 11: 72,208,101 (GRCm39) K151R probably benign Het
Fer A G 17: 64,214,327 (GRCm39) T87A probably benign Het
Fgf4 A T 7: 144,415,335 (GRCm39) N32Y possibly damaging Het
Fkbp6 G A 5: 135,375,027 (GRCm39) P129S probably damaging Het
Fndc7 C A 3: 108,774,597 (GRCm39) V554F probably damaging Het
Frk G A 10: 34,481,873 (GRCm39) probably null Het
Ghrhr T A 6: 55,357,786 (GRCm39) I139N possibly damaging Het
Gm17175 A T 14: 51,809,099 (GRCm39) M89K probably damaging Het
Gpihbp1 G A 15: 75,469,612 (GRCm39) C109Y probably damaging Het
Gps1 T C 11: 120,677,641 (GRCm39) V257A probably benign Het
H2-M3 T C 17: 37,581,159 (GRCm39) S3P probably benign Het
Hmcn1 G A 1: 150,475,303 (GRCm39) P4674L probably damaging Het
Hoxa11 T C 6: 52,222,224 (GRCm39) D159G probably benign Het
Kcnn4 G A 7: 24,083,503 (GRCm39) D395N probably damaging Het
Krt222 T C 11: 99,126,981 (GRCm39) E213G probably damaging Het
Lmcd1 A G 6: 112,306,785 (GRCm39) D319G possibly damaging Het
Ltv1 A G 10: 13,066,440 (GRCm39) F62S probably damaging Het
Man2a1 G T 17: 65,041,953 (GRCm39) R957L probably damaging Het
Mcm5 C T 8: 75,844,168 (GRCm39) S313F probably benign Het
Mrpl45 T G 11: 97,217,687 (GRCm39) V197G probably damaging Het
Ndn C T 7: 61,998,337 (GRCm39) P61L possibly damaging Het
Nek4 T C 14: 30,675,904 (GRCm39) Y73H probably damaging Het
Nom1 T A 5: 29,642,750 (GRCm39) V417D probably damaging Het
Or10q1b A T 19: 13,682,868 (GRCm39) I226F probably damaging Het
Or4k5 A G 14: 50,386,055 (GRCm39) I92T probably benign Het
Or5p68 A G 7: 107,945,513 (GRCm39) L225P probably damaging Het
Pacs1 A G 19: 5,193,862 (GRCm39) S556P probably damaging Het
Pcdh1 C T 18: 38,330,904 (GRCm39) V839M possibly damaging Het
Pcdhb18 T A 18: 37,623,694 (GRCm39) N341K probably damaging Het
Pde6d G A 1: 86,473,424 (GRCm39) T124M possibly damaging Het
Piezo2 T A 18: 63,280,016 (GRCm39) E185V probably benign Het
Pkhd1l1 T C 15: 44,442,029 (GRCm39) V3656A possibly damaging Het
Plcg1 A G 2: 160,597,671 (GRCm39) Y771C probably benign Het
Ppdpf T C 2: 180,829,668 (GRCm39) L41P probably benign Het
Prepl T C 17: 85,376,321 (GRCm39) T578A probably benign Het
Prkdc C A 16: 15,548,334 (GRCm39) L1981M possibly damaging Het
Prkdc T A 16: 15,548,335 (GRCm39) L1981Q probably damaging Het
Rb1cc1 C T 1: 6,318,528 (GRCm39) S649L probably benign Het
Rbbp6 A G 7: 122,591,268 (GRCm39) T457A possibly damaging Het
Sbf1 T A 15: 89,191,808 (GRCm39) probably null Het
Scn1a T C 2: 66,152,687 (GRCm39) I776V probably benign Het
Sec23a G A 12: 59,019,804 (GRCm39) P588S probably benign Het
Slfn5 A G 11: 82,851,830 (GRCm39) D652G possibly damaging Het
Slfn5 C A 11: 82,852,321 (GRCm39) P816T probably benign Het
Smarcad1 C T 6: 65,091,318 (GRCm39) T1013I probably damaging Het
Spidr G A 16: 15,855,474 (GRCm39) T347I probably benign Het
Stx1b A T 7: 127,406,551 (GRCm39) M266K probably damaging Het
Tarm1 A G 7: 3,551,062 (GRCm39) probably benign Het
Tfap2c A T 2: 172,391,764 (GRCm39) K4* probably null Het
Trpm5 A T 7: 142,633,148 (GRCm39) V819E possibly damaging Het
Trrap A G 5: 144,780,128 (GRCm39) T3240A possibly damaging Het
Uqcc2 A T 17: 27,341,709 (GRCm39) V130D probably benign Het
Uspl1 T A 5: 149,151,870 (GRCm39) D1023E probably benign Het
Vinac1 C T 2: 128,878,550 (GRCm39) W1125* probably null Het
Vmn2r28 A T 7: 5,491,220 (GRCm39) H342Q probably benign Het
Vmn2r33 A T 7: 7,557,153 (GRCm39) C516S possibly damaging Het
Vps45 G A 3: 95,940,982 (GRCm39) R420W probably damaging Het
Zfp42 C T 8: 43,749,172 (GRCm39) V110I possibly damaging Het
Zfp467 T A 6: 48,404,776 (GRCm39) K100N unknown Het
Zfyve16 A T 13: 92,636,788 (GRCm39) S1307R probably damaging Het
Other mutations in Gm4787
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01719:Gm4787 APN 12 81,423,948 (GRCm39) missense possibly damaging 0.50
IGL01916:Gm4787 APN 12 81,424,218 (GRCm39) missense probably benign 0.36
IGL02193:Gm4787 APN 12 81,425,302 (GRCm39) missense probably benign 0.02
IGL02623:Gm4787 APN 12 81,425,502 (GRCm39) missense probably damaging 1.00
IGL02681:Gm4787 APN 12 81,425,543 (GRCm39) missense possibly damaging 0.88
IGL03257:Gm4787 APN 12 81,424,826 (GRCm39) missense probably damaging 1.00
IGL03410:Gm4787 APN 12 81,425,948 (GRCm39) missense probably damaging 1.00
F5770:Gm4787 UTSW 12 81,424,341 (GRCm39) nonsense probably null
PIT4362001:Gm4787 UTSW 12 81,423,949 (GRCm39) missense probably benign
R0070:Gm4787 UTSW 12 81,425,840 (GRCm39) missense probably damaging 1.00
R0128:Gm4787 UTSW 12 81,424,521 (GRCm39) nonsense probably null
R0220:Gm4787 UTSW 12 81,425,422 (GRCm39) missense probably damaging 0.98
R0304:Gm4787 UTSW 12 81,425,708 (GRCm39) missense probably damaging 1.00
R0513:Gm4787 UTSW 12 81,425,086 (GRCm39) missense probably benign 0.03
R1761:Gm4787 UTSW 12 81,423,950 (GRCm39) missense probably benign 0.02
R1809:Gm4787 UTSW 12 81,425,303 (GRCm39) missense possibly damaging 0.91
R1853:Gm4787 UTSW 12 81,425,108 (GRCm39) missense probably damaging 1.00
R1854:Gm4787 UTSW 12 81,425,108 (GRCm39) missense probably damaging 1.00
R2030:Gm4787 UTSW 12 81,425,544 (GRCm39) missense probably damaging 1.00
R2063:Gm4787 UTSW 12 81,425,694 (GRCm39) missense probably benign 0.39
R2112:Gm4787 UTSW 12 81,424,607 (GRCm39) missense probably damaging 1.00
R2140:Gm4787 UTSW 12 81,425,336 (GRCm39) missense probably benign 0.03
R2151:Gm4787 UTSW 12 81,423,993 (GRCm39) missense probably benign 0.00
R2152:Gm4787 UTSW 12 81,423,993 (GRCm39) missense probably benign 0.00
R2342:Gm4787 UTSW 12 81,425,532 (GRCm39) missense possibly damaging 0.91
R2504:Gm4787 UTSW 12 81,425,911 (GRCm39) missense possibly damaging 0.93
R4038:Gm4787 UTSW 12 81,425,132 (GRCm39) missense probably damaging 1.00
R4604:Gm4787 UTSW 12 81,425,987 (GRCm39) missense probably benign 0.17
R4748:Gm4787 UTSW 12 81,424,830 (GRCm39) missense probably damaging 1.00
R4750:Gm4787 UTSW 12 81,425,141 (GRCm39) missense possibly damaging 0.95
R4928:Gm4787 UTSW 12 81,425,612 (GRCm39) missense probably benign 0.03
R4960:Gm4787 UTSW 12 81,426,090 (GRCm39) missense probably damaging 0.99
R4974:Gm4787 UTSW 12 81,424,403 (GRCm39) missense probably damaging 0.99
R5028:Gm4787 UTSW 12 81,424,604 (GRCm39) missense probably benign 0.01
R5029:Gm4787 UTSW 12 81,424,604 (GRCm39) missense probably benign 0.01
R5031:Gm4787 UTSW 12 81,424,604 (GRCm39) missense probably benign 0.01
R5098:Gm4787 UTSW 12 81,424,604 (GRCm39) missense probably benign 0.01
R5099:Gm4787 UTSW 12 81,424,604 (GRCm39) missense probably benign 0.01
R5100:Gm4787 UTSW 12 81,424,604 (GRCm39) missense probably benign 0.01
R5101:Gm4787 UTSW 12 81,424,604 (GRCm39) missense probably benign 0.01
R5135:Gm4787 UTSW 12 81,424,604 (GRCm39) missense probably benign 0.01
R5152:Gm4787 UTSW 12 81,425,451 (GRCm39) missense probably benign 0.02
R5180:Gm4787 UTSW 12 81,424,604 (GRCm39) missense probably benign 0.01
R5220:Gm4787 UTSW 12 81,424,604 (GRCm39) missense probably benign 0.01
R5257:Gm4787 UTSW 12 81,424,604 (GRCm39) missense probably benign 0.01
R5258:Gm4787 UTSW 12 81,424,604 (GRCm39) missense probably benign 0.01
R5297:Gm4787 UTSW 12 81,424,604 (GRCm39) missense probably benign 0.01
R5324:Gm4787 UTSW 12 81,424,604 (GRCm39) missense probably benign 0.01
R5325:Gm4787 UTSW 12 81,424,604 (GRCm39) missense probably benign 0.01
R5355:Gm4787 UTSW 12 81,424,239 (GRCm39) nonsense probably null
R5364:Gm4787 UTSW 12 81,424,604 (GRCm39) missense probably benign 0.01
R5396:Gm4787 UTSW 12 81,424,604 (GRCm39) missense probably benign 0.01
R5397:Gm4787 UTSW 12 81,424,604 (GRCm39) missense probably benign 0.01
R5398:Gm4787 UTSW 12 81,424,604 (GRCm39) missense probably benign 0.01
R5514:Gm4787 UTSW 12 81,425,102 (GRCm39) missense possibly damaging 0.90
R5634:Gm4787 UTSW 12 81,424,604 (GRCm39) missense probably benign 0.01
R5666:Gm4787 UTSW 12 81,424,805 (GRCm39) missense probably benign 0.23
R5670:Gm4787 UTSW 12 81,424,805 (GRCm39) missense probably benign 0.23
R5787:Gm4787 UTSW 12 81,424,604 (GRCm39) missense probably benign 0.01
R5788:Gm4787 UTSW 12 81,424,604 (GRCm39) missense probably benign 0.01
R6354:Gm4787 UTSW 12 81,424,755 (GRCm39) missense probably damaging 1.00
R6932:Gm4787 UTSW 12 81,425,974 (GRCm39) missense probably benign 0.04
R7120:Gm4787 UTSW 12 81,425,260 (GRCm39) missense probably benign 0.00
R7237:Gm4787 UTSW 12 81,424,442 (GRCm39) missense probably damaging 0.99
R7937:Gm4787 UTSW 12 81,424,679 (GRCm39) missense probably benign 0.01
R8022:Gm4787 UTSW 12 81,424,494 (GRCm39) missense possibly damaging 0.94
R8140:Gm4787 UTSW 12 81,424,925 (GRCm39) missense probably benign 0.00
R8314:Gm4787 UTSW 12 81,425,909 (GRCm39) missense probably damaging 1.00
R8480:Gm4787 UTSW 12 81,424,280 (GRCm39) missense probably damaging 1.00
R8498:Gm4787 UTSW 12 81,425,840 (GRCm39) missense probably damaging 1.00
R8515:Gm4787 UTSW 12 81,424,043 (GRCm39) missense probably benign 0.00
R9103:Gm4787 UTSW 12 81,425,489 (GRCm39) missense probably benign 0.06
R9457:Gm4787 UTSW 12 81,426,020 (GRCm39) missense probably damaging 1.00
R9557:Gm4787 UTSW 12 81,426,074 (GRCm39) nonsense probably null
V7580:Gm4787 UTSW 12 81,424,341 (GRCm39) nonsense probably null
V7581:Gm4787 UTSW 12 81,424,341 (GRCm39) nonsense probably null
V7582:Gm4787 UTSW 12 81,424,341 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- CACAGTCACAGCTCTCACTG -3'
(R):5'- GAGCATGCCACTACAGCTCTTC -3'

Sequencing Primer
(F):5'- TCTTATTTCCACAACGAGGAACG -3'
(R):5'- CTTCTCCTTGGAAGAAAACTTGG -3'
Posted On 2022-09-12