Incidental Mutation 'R9608:Gm4787'
ID 724038
Institutional Source Beutler Lab
Gene Symbol Gm4787
Ensembl Gene ENSMUSG00000072974
Gene Name predicted gene 4787
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock # R9608 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 81376991-81379464 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 81378312 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 357 (N357K)
Ref Sequence ENSEMBL: ENSMUSP00000077390 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062182] [ENSMUST00000110340] [ENSMUST00000164386] [ENSMUST00000166723]
AlphaFold B2RUD9
Predicted Effect probably benign
Transcript: ENSMUST00000062182
AA Change: N357K

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000077390
Gene: ENSMUSG00000072974
AA Change: N357K

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
Pfam:Pep_M12B_propep 46 163 1.5e-19 PFAM
Pfam:Reprolysin 213 406 4.6e-18 PFAM
DISIN 425 500 2e-33 SMART
ACR 501 644 2.83e-53 SMART
transmembrane domain 714 736 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110340
SMART Domains Protein: ENSMUSP00000105969
Gene: ENSMUSG00000091803

DomainStartEndE-ValueType
Pfam:COX16 16 74 6.6e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164386
SMART Domains Protein: ENSMUSP00000132941
Gene: ENSMUSG00000021139

DomainStartEndE-ValueType
PDZ 21 100 6.16e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166723
SMART Domains Protein: ENSMUSP00000130935
Gene: ENSMUSG00000091803

DomainStartEndE-ValueType
Pfam:COX16 16 73 6.9e-16 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl5 T A 19: 55,284,452 I333N probably damaging Het
Adam2 T C 14: 66,053,830 N333S probably null Het
Adgrb2 A G 4: 130,013,559 T955A probably damaging Het
Agxt2 T C 15: 10,400,538 F476S possibly damaging Het
Asb14 T A 14: 26,912,191 F451Y probably damaging Het
Atg9a A T 1: 75,185,095 N602K possibly damaging Het
Atp2a3 T C 11: 72,989,040 I978T probably benign Het
BC034090 A G 1: 155,223,389 V550A possibly damaging Het
Bud23 T A 5: 135,057,672 probably null Het
C1qtnf3 A T 15: 10,952,482 H10L probably benign Het
Cage1 G C 13: 38,011,395 I783M possibly damaging Het
Ccdc142 C T 6: 83,107,101 Q496* probably null Het
Cd163 A C 6: 124,309,204 K238Q possibly damaging Het
Cdh6 A T 15: 13,064,535 Y90N probably damaging Het
Cpeb1 A G 7: 81,372,010 probably null Het
Cpt2 G T 4: 107,908,144 P141Q probably damaging Het
Cspg4 T A 9: 56,885,552 H190Q probably benign Het
Dcst1 T C 3: 89,359,135 M139V possibly damaging Het
Dennd5a G C 7: 109,921,506 N381K probably damaging Het
Dera A G 6: 137,836,878 R299G possibly damaging Het
Dnah2 C T 11: 69,454,062 G2729R probably null Het
Dnajc11 A G 4: 151,950,521 E67G possibly damaging Het
Eif2ak3 T A 6: 70,864,527 C152* probably null Het
Eln T G 5: 134,726,477 K241Q unknown Het
Exoc6b C T 6: 84,625,124 probably null Het
Eya1 A T 1: 14,302,805 I30K probably benign Het
Fbxo39 A G 11: 72,317,275 K151R probably benign Het
Fer A G 17: 63,907,332 T87A probably benign Het
Fgf4 A T 7: 144,861,598 N32Y possibly damaging Het
Fkbp6 G A 5: 135,346,173 P129S probably damaging Het
Fndc7 C A 3: 108,867,281 V554F probably damaging Het
Frk G A 10: 34,605,877 probably null Het
Ghrhr T A 6: 55,380,801 I139N possibly damaging Het
Gm14025 C T 2: 129,036,630 W1125* probably null Het
Gm17175 A T 14: 51,571,642 M89K probably damaging Het
Gpihbp1 G A 15: 75,597,763 C109Y probably damaging Het
Gps1 T C 11: 120,786,815 V257A probably benign Het
H2-M3 T C 17: 37,270,268 S3P probably benign Het
Hmcn1 G A 1: 150,599,552 P4674L probably damaging Het
Hoxa11 T C 6: 52,245,244 D159G probably benign Het
Kcnn4 G A 7: 24,384,078 D395N probably damaging Het
Krt222 T C 11: 99,236,155 E213G probably damaging Het
Lmcd1 A G 6: 112,329,824 D319G possibly damaging Het
Ltv1 A G 10: 13,190,696 F62S probably damaging Het
Man2a1 G T 17: 64,734,958 R957L probably damaging Het
Mcm5 C T 8: 75,117,540 S313F probably benign Het
Mrpl45 T G 11: 97,326,861 V197G probably damaging Het
Ndn C T 7: 62,348,589 P61L possibly damaging Het
Nek4 T C 14: 30,953,947 Y73H probably damaging Het
Nom1 T A 5: 29,437,752 V417D probably damaging Het
Olfr1491 A T 19: 13,705,504 I226F probably damaging Het
Olfr493 A G 7: 108,346,306 L225P probably damaging Het
Olfr729 A G 14: 50,148,598 I92T probably benign Het
Pacs1 A G 19: 5,143,834 S556P probably damaging Het
Pcdh1 C T 18: 38,197,851 V839M possibly damaging Het
Pcdhb18 T A 18: 37,490,641 N341K probably damaging Het
Pde6d G A 1: 86,545,702 T124M possibly damaging Het
Piezo2 T A 18: 63,146,945 E185V probably benign Het
Pkhd1l1 T C 15: 44,578,633 V3656A possibly damaging Het
Plcg1 A G 2: 160,755,751 Y771C probably benign Het
Ppdpf T C 2: 181,187,875 L41P probably benign Het
Prepl T C 17: 85,068,893 T578A probably benign Het
Prkdc C A 16: 15,730,470 L1981M possibly damaging Het
Prkdc T A 16: 15,730,471 L1981Q probably damaging Het
Rb1cc1 C T 1: 6,248,304 S649L probably benign Het
Rbbp6 A G 7: 122,992,045 T457A possibly damaging Het
Sbf1 T A 15: 89,307,605 probably null Het
Scn1a T C 2: 66,322,343 I776V probably benign Het
Sec23a G A 12: 58,973,018 P588S probably benign Het
Slfn5 A G 11: 82,961,004 D652G possibly damaging Het
Slfn5 C A 11: 82,961,495 P816T probably benign Het
Smarcad1 C T 6: 65,114,334 T1013I probably damaging Het
Spidr G A 16: 16,037,610 T347I probably benign Het
Stx1b A T 7: 127,807,379 M266K probably damaging Het
Tarm1 A G 7: 3,502,546 probably benign Het
Tfap2c A T 2: 172,549,844 K4* probably null Het
Trpm5 A T 7: 143,079,411 V819E possibly damaging Het
Trrap A G 5: 144,843,318 T3240A possibly damaging Het
Uqcc2 A T 17: 27,122,735 V130D probably benign Het
Uspl1 T A 5: 149,215,060 D1023E probably benign Het
Vmn2r28 A T 7: 5,488,221 H342Q probably benign Het
Vmn2r33 A T 7: 7,554,154 C516S possibly damaging Het
Vps45 G A 3: 96,033,670 R420W probably damaging Het
Zfp42 C T 8: 43,296,135 V110I possibly damaging Het
Zfp467 T A 6: 48,427,842 K100N unknown Het
Zfyve16 A T 13: 92,500,280 S1307R probably damaging Het
Other mutations in Gm4787
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01719:Gm4787 APN 12 81377174 missense possibly damaging 0.50
IGL01916:Gm4787 APN 12 81377444 missense probably benign 0.36
IGL02193:Gm4787 APN 12 81378528 missense probably benign 0.02
IGL02623:Gm4787 APN 12 81378728 missense probably damaging 1.00
IGL02681:Gm4787 APN 12 81378769 missense possibly damaging 0.88
IGL03257:Gm4787 APN 12 81378052 missense probably damaging 1.00
IGL03410:Gm4787 APN 12 81379174 missense probably damaging 1.00
F5770:Gm4787 UTSW 12 81377567 nonsense probably null
PIT4362001:Gm4787 UTSW 12 81377175 missense probably benign
R0070:Gm4787 UTSW 12 81379066 missense probably damaging 1.00
R0128:Gm4787 UTSW 12 81377747 nonsense probably null
R0220:Gm4787 UTSW 12 81378648 missense probably damaging 0.98
R0304:Gm4787 UTSW 12 81378934 missense probably damaging 1.00
R0513:Gm4787 UTSW 12 81378312 missense probably benign 0.03
R1761:Gm4787 UTSW 12 81377176 missense probably benign 0.02
R1809:Gm4787 UTSW 12 81378529 missense possibly damaging 0.91
R1853:Gm4787 UTSW 12 81378334 missense probably damaging 1.00
R1854:Gm4787 UTSW 12 81378334 missense probably damaging 1.00
R2030:Gm4787 UTSW 12 81378770 missense probably damaging 1.00
R2063:Gm4787 UTSW 12 81378920 missense probably benign 0.39
R2112:Gm4787 UTSW 12 81377833 missense probably damaging 1.00
R2140:Gm4787 UTSW 12 81378562 missense probably benign 0.03
R2151:Gm4787 UTSW 12 81377219 missense probably benign 0.00
R2152:Gm4787 UTSW 12 81377219 missense probably benign 0.00
R2342:Gm4787 UTSW 12 81378758 missense possibly damaging 0.91
R2504:Gm4787 UTSW 12 81379137 missense possibly damaging 0.93
R4038:Gm4787 UTSW 12 81378358 missense probably damaging 1.00
R4604:Gm4787 UTSW 12 81379213 missense probably benign 0.17
R4748:Gm4787 UTSW 12 81378056 missense probably damaging 1.00
R4750:Gm4787 UTSW 12 81378367 missense possibly damaging 0.95
R4928:Gm4787 UTSW 12 81378838 missense probably benign 0.03
R4960:Gm4787 UTSW 12 81379316 missense probably damaging 0.99
R4974:Gm4787 UTSW 12 81377629 missense probably damaging 0.99
R5028:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5029:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5031:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5098:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5099:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5100:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5101:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5135:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5152:Gm4787 UTSW 12 81378677 missense probably benign 0.02
R5180:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5220:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5257:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5258:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5297:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5324:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5325:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5355:Gm4787 UTSW 12 81377465 nonsense probably null
R5364:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5396:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5397:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5398:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5514:Gm4787 UTSW 12 81378328 missense possibly damaging 0.90
R5634:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5666:Gm4787 UTSW 12 81378031 missense probably benign 0.23
R5670:Gm4787 UTSW 12 81378031 missense probably benign 0.23
R5787:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5788:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R6354:Gm4787 UTSW 12 81377981 missense probably damaging 1.00
R6932:Gm4787 UTSW 12 81379200 missense probably benign 0.04
R7120:Gm4787 UTSW 12 81378486 missense probably benign 0.00
R7237:Gm4787 UTSW 12 81377668 missense probably damaging 0.99
R7937:Gm4787 UTSW 12 81377905 missense probably benign 0.01
R8022:Gm4787 UTSW 12 81377720 missense possibly damaging 0.94
R8140:Gm4787 UTSW 12 81378151 missense probably benign 0.00
R8314:Gm4787 UTSW 12 81379135 missense probably damaging 1.00
R8480:Gm4787 UTSW 12 81377506 missense probably damaging 1.00
R8498:Gm4787 UTSW 12 81379066 missense probably damaging 1.00
R8515:Gm4787 UTSW 12 81377269 missense probably benign 0.00
R9103:Gm4787 UTSW 12 81378715 missense probably benign 0.06
R9457:Gm4787 UTSW 12 81379246 missense probably damaging 1.00
R9557:Gm4787 UTSW 12 81379300 nonsense probably null
V7580:Gm4787 UTSW 12 81377567 nonsense probably null
V7581:Gm4787 UTSW 12 81377567 nonsense probably null
V7582:Gm4787 UTSW 12 81377567 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CACAGTCACAGCTCTCACTG -3'
(R):5'- GAGCATGCCACTACAGCTCTTC -3'

Sequencing Primer
(F):5'- TCTTATTTCCACAACGAGGAACG -3'
(R):5'- CTTCTCCTTGGAAGAAAACTTGG -3'
Posted On 2022-09-12