Incidental Mutation 'R9610:Arhgef5'
ID 724142
Institutional Source Beutler Lab
Gene Symbol Arhgef5
Ensembl Gene ENSMUSG00000033542
Gene Name Rho guanine nucleotide exchange factor 5
Synonyms 2210412D05Rik
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9610 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 43242578-43266254 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 43257890 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Methionine at position 1311 (I1311M)
Ref Sequence ENSEMBL: ENSMUSP00000031750 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031750]
AlphaFold E9Q7D5
Predicted Effect probably damaging
Transcript: ENSMUST00000031750
AA Change: I1311M

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000031750
Gene: ENSMUSG00000033542
AA Change: I1311M

DomainStartEndE-ValueType
Pfam:ARHGEF5_35 1 477 3.1e-220 PFAM
low complexity region 509 531 N/A INTRINSIC
low complexity region 812 825 N/A INTRINSIC
low complexity region 827 851 N/A INTRINSIC
RhoGEF 1162 1341 2.97e-57 SMART
PH 1375 1488 1.11e-6 SMART
SH3 1497 1554 6.39e-15 SMART
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho GTPases play a fundamental role in numerous cellular processes initiated by extracellular stimuli that work through G protein coupled receptors. The encoded protein may form a complex with G proteins and stimulate Rho-dependent signals. This protein may be involved in the control of cytoskeletal organization. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased Th2 response in an ovalbumin-induced asthma model. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts19 A T 18: 59,023,399 (GRCm39) T265S probably benign Het
Bcr T A 10: 74,990,743 (GRCm39) Y750N probably damaging Het
Bcr T A 10: 74,990,745 (GRCm39) Y750* probably null Het
Btbd16 T A 7: 130,407,595 (GRCm39) M295K probably benign Het
Ccdc88a T C 11: 29,427,316 (GRCm39) L1007P possibly damaging Het
Cnep1r1 A G 8: 88,860,457 (GRCm39) *126W probably null Het
Cstf1 T A 2: 172,214,984 (GRCm39) I35N probably benign Het
Cstpp1 T C 2: 91,135,127 (GRCm39) D111G probably damaging Het
Cul9 A G 17: 46,830,823 (GRCm39) L1690P possibly damaging Het
Dnm2 A T 9: 21,414,973 (GRCm39) K677* probably null Het
Dscaml1 C A 9: 45,579,522 (GRCm39) N356K possibly damaging Het
Dvl3 A G 16: 20,346,008 (GRCm39) D446G probably damaging Het
Ecm2 A G 13: 49,668,518 (GRCm39) N74D probably benign Het
Ecm2 A G 13: 49,681,216 (GRCm39) I450M probably damaging Het
Emc1 T A 4: 139,091,035 (GRCm39) D460E probably benign Het
Fhip2b T C 14: 70,824,258 (GRCm39) Y493C probably benign Het
Fuom T A 7: 139,679,828 (GRCm39) E121V possibly damaging Het
Fyco1 T C 9: 123,657,585 (GRCm39) T864A possibly damaging Het
Galk2 T C 2: 125,817,218 (GRCm39) Y336H probably damaging Het
Gcsh T A 8: 117,720,125 (GRCm39) Y14F probably benign Het
Grip1 G A 10: 119,874,569 (GRCm39) E778K possibly damaging Het
Gucy2g T C 19: 55,194,605 (GRCm39) I937M probably damaging Het
Hsp90ab1 T C 17: 45,880,600 (GRCm39) I370M possibly damaging Het
Hypk T C 2: 121,288,154 (GRCm39) S72P probably damaging Het
Izumo1r T G 9: 14,811,840 (GRCm39) I183L possibly damaging Het
Kctd13 G T 7: 126,544,180 (GRCm39) G293C probably damaging Het
Kmt2d CTGTTG CTG 15: 98,743,057 (GRCm39) probably benign Het
Krt13 T C 11: 100,012,318 (GRCm39) S2G probably benign Het
Mark4 C A 7: 19,167,338 (GRCm39) R467L possibly damaging Het
Mrps33 T A 6: 39,779,422 (GRCm39) K91M probably damaging Het
Muc5ac T A 7: 141,350,078 (GRCm39) V608D possibly damaging Het
Myb G A 10: 21,030,627 (GRCm39) Q57* probably null Het
Or51f1 T G 7: 102,506,147 (GRCm39) H114P probably damaging Het
Peg10 GCAC GCACCAC 6: 4,756,452 (GRCm39) probably benign Het
Phldb3 G A 7: 24,328,372 (GRCm39) V639M probably damaging Het
Pip4k2c A C 10: 127,036,069 (GRCm39) L266R probably damaging Het
Plg T C 17: 12,609,213 (GRCm39) Y173H probably benign Het
Pmp22 G T 11: 63,024,065 (GRCm39) V25F probably benign Het
Ppp1r16b T A 2: 158,537,998 (GRCm39) Y40N probably damaging Het
Prl5a1 A G 13: 28,329,492 (GRCm39) E57G possibly damaging Het
Psmb10 A G 8: 106,664,144 (GRCm39) F75S probably benign Het
Ptprm C A 17: 67,000,483 (GRCm39) R1167M probably damaging Het
Rbm46 T C 3: 82,771,541 (GRCm39) H358R probably benign Het
Rgl1 A G 1: 152,397,115 (GRCm39) S684P probably benign Het
Rmnd5b T C 11: 51,517,869 (GRCm39) I162V probably damaging Het
Sh3d19 T C 3: 86,014,529 (GRCm39) V440A possibly damaging Het
Sik1 T A 17: 32,073,246 (GRCm39) K70M probably damaging Het
Slc44a4 C T 17: 35,147,793 (GRCm39) S611F probably benign Het
Stk32a A G 18: 43,430,620 (GRCm39) I177V probably benign Het
Syt7 G A 19: 10,421,459 (GRCm39) D548N probably benign Het
Tcf7l2 A G 19: 55,899,038 (GRCm39) D215G probably null Het
Tex14 T A 11: 87,377,084 (GRCm39) F143I probably damaging Het
Tjp3 A G 10: 81,119,411 (GRCm39) V26A possibly damaging Het
Tpx2 T A 2: 152,715,124 (GRCm39) V115D probably benign Het
Tubb2b C A 13: 34,311,742 (GRCm39) K350N probably damaging Het
Usf3 T C 16: 44,036,936 (GRCm39) V472A probably benign Het
Vps13b G T 15: 35,642,555 (GRCm39) G1389V possibly damaging Het
Vps39 T C 2: 120,172,485 (GRCm39) R183G probably damaging Het
Wnk4 G T 11: 101,159,250 (GRCm39) E556* probably null Het
Xpo7 T A 14: 70,925,617 (GRCm39) E474V probably benign Het
Zbtb18 A G 1: 177,275,341 (GRCm39) R234G probably null Het
Zc3h14 T A 12: 98,737,663 (GRCm39) I50N possibly damaging Het
Zfat A G 15: 68,051,655 (GRCm39) V713A possibly damaging Het
Zfp462 T C 4: 55,009,545 (GRCm39) S504P possibly damaging Het
Zmiz1 T C 14: 25,651,022 (GRCm39) V502A probably benign Het
Other mutations in Arhgef5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00341:Arhgef5 APN 6 43,257,203 (GRCm39) nonsense probably null
IGL01341:Arhgef5 APN 6 43,260,925 (GRCm39) missense probably damaging 1.00
IGL01576:Arhgef5 APN 6 43,250,962 (GRCm39) missense probably benign 0.38
IGL01761:Arhgef5 APN 6 43,251,538 (GRCm39) missense probably benign 0.00
IGL02104:Arhgef5 APN 6 43,249,345 (GRCm39) missense probably damaging 0.99
IGL02208:Arhgef5 APN 6 43,252,064 (GRCm39) missense probably benign 0.11
IGL02487:Arhgef5 APN 6 43,260,916 (GRCm39) missense probably damaging 1.00
IGL02650:Arhgef5 APN 6 43,249,869 (GRCm39) nonsense probably null
IGL03292:Arhgef5 APN 6 43,257,180 (GRCm39) missense probably damaging 1.00
IGL03334:Arhgef5 APN 6 43,250,934 (GRCm39) missense possibly damaging 0.47
IGL03341:Arhgef5 APN 6 43,257,585 (GRCm39) missense probably damaging 0.99
R0047:Arhgef5 UTSW 6 43,242,555 (GRCm39) splice site probably null
R0206:Arhgef5 UTSW 6 43,250,275 (GRCm39) missense probably damaging 1.00
R0208:Arhgef5 UTSW 6 43,250,275 (GRCm39) missense probably damaging 1.00
R0698:Arhgef5 UTSW 6 43,250,275 (GRCm39) missense probably damaging 1.00
R1145:Arhgef5 UTSW 6 43,250,022 (GRCm39) missense possibly damaging 0.92
R1145:Arhgef5 UTSW 6 43,250,022 (GRCm39) missense possibly damaging 0.92
R1168:Arhgef5 UTSW 6 43,250,330 (GRCm39) missense probably benign 0.00
R1355:Arhgef5 UTSW 6 43,260,846 (GRCm39) missense probably damaging 1.00
R1370:Arhgef5 UTSW 6 43,260,846 (GRCm39) missense probably damaging 1.00
R1481:Arhgef5 UTSW 6 43,251,568 (GRCm39) missense probably damaging 0.99
R1529:Arhgef5 UTSW 6 43,256,449 (GRCm39) missense probably damaging 0.96
R1532:Arhgef5 UTSW 6 43,250,337 (GRCm39) missense probably benign
R1663:Arhgef5 UTSW 6 43,253,899 (GRCm39) missense probably damaging 1.00
R1742:Arhgef5 UTSW 6 43,257,133 (GRCm39) missense probably damaging 1.00
R1852:Arhgef5 UTSW 6 43,252,119 (GRCm39) missense probably benign 0.00
R1869:Arhgef5 UTSW 6 43,265,616 (GRCm39) missense probably damaging 1.00
R1880:Arhgef5 UTSW 6 43,250,022 (GRCm39) missense possibly damaging 0.92
R2146:Arhgef5 UTSW 6 43,260,252 (GRCm39) missense probably damaging 1.00
R2169:Arhgef5 UTSW 6 43,251,354 (GRCm39) missense probably benign 0.11
R3412:Arhgef5 UTSW 6 43,250,724 (GRCm39) missense probably benign
R4205:Arhgef5 UTSW 6 43,250,766 (GRCm39) missense possibly damaging 0.76
R4226:Arhgef5 UTSW 6 43,256,432 (GRCm39) missense probably damaging 1.00
R4227:Arhgef5 UTSW 6 43,256,432 (GRCm39) missense probably damaging 1.00
R4304:Arhgef5 UTSW 6 43,256,432 (GRCm39) missense probably damaging 1.00
R4308:Arhgef5 UTSW 6 43,256,432 (GRCm39) missense probably damaging 1.00
R4457:Arhgef5 UTSW 6 43,251,027 (GRCm39) missense probably damaging 1.00
R4469:Arhgef5 UTSW 6 43,252,033 (GRCm39) missense probably benign
R4636:Arhgef5 UTSW 6 43,251,876 (GRCm39) missense probably benign 0.11
R4791:Arhgef5 UTSW 6 43,260,117 (GRCm39) missense probably damaging 1.00
R4818:Arhgef5 UTSW 6 43,250,484 (GRCm39) missense probably benign 0.00
R4910:Arhgef5 UTSW 6 43,249,762 (GRCm39) missense probably benign 0.01
R4911:Arhgef5 UTSW 6 43,249,762 (GRCm39) missense probably benign 0.01
R5127:Arhgef5 UTSW 6 43,250,148 (GRCm39) missense probably damaging 0.99
R5209:Arhgef5 UTSW 6 43,250,634 (GRCm39) missense probably benign 0.01
R5245:Arhgef5 UTSW 6 43,242,614 (GRCm39) start gained probably benign
R5251:Arhgef5 UTSW 6 43,249,815 (GRCm39) missense possibly damaging 0.76
R5513:Arhgef5 UTSW 6 43,249,273 (GRCm39) missense probably damaging 0.96
R5613:Arhgef5 UTSW 6 43,250,997 (GRCm39) missense probably benign 0.01
R5616:Arhgef5 UTSW 6 43,252,874 (GRCm39) missense probably benign 0.20
R5817:Arhgef5 UTSW 6 43,252,038 (GRCm39) missense probably benign 0.15
R6024:Arhgef5 UTSW 6 43,252,068 (GRCm39) missense probably benign 0.00
R6735:Arhgef5 UTSW 6 43,251,966 (GRCm39) missense probably benign 0.01
R6825:Arhgef5 UTSW 6 43,251,895 (GRCm39) missense probably damaging 0.99
R6831:Arhgef5 UTSW 6 43,257,933 (GRCm39) missense probably damaging 1.00
R6901:Arhgef5 UTSW 6 43,250,232 (GRCm39) missense probably benign 0.00
R6932:Arhgef5 UTSW 6 43,251,351 (GRCm39) missense possibly damaging 0.94
R6968:Arhgef5 UTSW 6 43,252,276 (GRCm39) missense probably benign 0.00
R7018:Arhgef5 UTSW 6 43,265,665 (GRCm39) missense probably damaging 1.00
R7180:Arhgef5 UTSW 6 43,252,142 (GRCm39) missense possibly damaging 0.87
R7201:Arhgef5 UTSW 6 43,250,166 (GRCm39) nonsense probably null
R7358:Arhgef5 UTSW 6 43,256,507 (GRCm39) missense probably damaging 1.00
R7359:Arhgef5 UTSW 6 43,257,216 (GRCm39) missense probably damaging 1.00
R7468:Arhgef5 UTSW 6 43,257,605 (GRCm39) nonsense probably null
R7503:Arhgef5 UTSW 6 43,250,933 (GRCm39) missense probably benign 0.15
R7699:Arhgef5 UTSW 6 43,251,691 (GRCm39) missense probably benign 0.11
R7700:Arhgef5 UTSW 6 43,251,691 (GRCm39) missense probably benign 0.11
R7737:Arhgef5 UTSW 6 43,250,728 (GRCm39) missense possibly damaging 0.84
R7847:Arhgef5 UTSW 6 43,252,069 (GRCm39) nonsense probably null
R7950:Arhgef5 UTSW 6 43,250,859 (GRCm39) missense possibly damaging 0.76
R8161:Arhgef5 UTSW 6 43,260,885 (GRCm39) missense probably damaging 1.00
R8178:Arhgef5 UTSW 6 43,252,119 (GRCm39) missense probably benign 0.00
R8203:Arhgef5 UTSW 6 43,257,579 (GRCm39) missense probably damaging 1.00
R8318:Arhgef5 UTSW 6 43,252,933 (GRCm39) critical splice donor site probably null
R8857:Arhgef5 UTSW 6 43,264,558 (GRCm39) missense probably damaging 1.00
R9499:Arhgef5 UTSW 6 43,260,940 (GRCm39) missense
R9611:Arhgef5 UTSW 6 43,257,890 (GRCm39) missense probably damaging 0.99
R9623:Arhgef5 UTSW 6 43,251,736 (GRCm39) missense possibly damaging 0.86
R9685:Arhgef5 UTSW 6 43,250,527 (GRCm39) missense probably benign 0.11
RF023:Arhgef5 UTSW 6 43,256,407 (GRCm39) missense probably damaging 1.00
X0028:Arhgef5 UTSW 6 43,250,635 (GRCm39) missense probably benign 0.03
X0065:Arhgef5 UTSW 6 43,249,342 (GRCm39) missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CCTTGACTCAGACATGGTCTTG -3'
(R):5'- TGACTGAGCTCTCCCCTTAG -3'

Sequencing Primer
(F):5'- CTCAGACATGGTCTTGGAGAG -3'
(R):5'- GAGCTCTCCCCTTAGTGTGG -3'
Posted On 2022-09-12