Mutagenetix > Incidental Mutation

Incidental Mutation 'R9610:Adamts19'

724189

Institutional Source

Beutler Lab

Gene Symbol

Adamts19

Ensembl Gene

ENSMUSG00000053441

Gene Name

a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 19

Synonyms

D230034E10Rik

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9610 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

58836764-59053678 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 58890327 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Serine at position 265 (T265S)

Ref Sequence

ENSEMBL: ENSMUSP00000050535 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000052907]

AlphaFold

P59509

Predicted Effect

probably benign
Transcript: ENSMUST00000052907
AA Change: T265S

PolyPhen 2 Score 0.264 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000050535
Gene: ENSMUSG00000053441
AA Change: T265S

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
low complexity region	57	84	N/A	INTRINSIC
low complexity region	109	124	N/A	INTRINSIC
Pfam:Pep_M12B_propep	131	276	1.6e-21	PFAM
Pfam:Reprolysin_5	326	523	1.7e-13	PFAM
Pfam:Reprolysin_4	328	544	2e-10	PFAM
Pfam:Reprolysin	328	548	9e-22	PFAM
Pfam:Reprolysin_2	346	537	1.6e-9	PFAM
Pfam:Reprolysin_3	350	496	3.4e-12	PFAM
low complexity region	551	562	N/A	INTRINSIC
TSP1	639	689	5.68e-9	SMART
Pfam:ADAM_spacer1	793	903	1.1e-31	PFAM
TSP1	922	980	4.95e-2	SMART
TSP1	982	1040	4.95e-2	SMART
TSP1	1042	1086	1.62e-4	SMART
TSP1	1093	1147	1.03e-6	SMART
Pfam:PLAC	1167	1199	4.2e-9	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. This gene is predominantly expressed in the ovary with lower levels of expression observed in kidney, heart, skeletal muscle, lung and testis. The encoded preproprotein undergoes proteolytic processing to generate an active protease. [provided by RefSeq, Jul 2016]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110051M20Rik	T	C	2: 91,304,782	D111G	probably damaging	Het
Arhgef5	A	G	6: 43,280,956	I1311M	probably damaging	Het
Bcr	T	A	10: 75,154,911	Y750N	probably damaging	Het
Bcr	T	A	10: 75,154,913	Y750*	probably null	Het
Btbd16	T	A	7: 130,805,865	M295K	probably benign	Het
Ccdc88a	T	C	11: 29,477,316	L1007P	possibly damaging	Het
Cnep1r1	A	G	8: 88,133,829	*126W	probably null	Het
Cstf1	T	A	2: 172,373,064	I35N	probably benign	Het
Cul9	A	G	17: 46,519,897	L1690P	possibly damaging	Het
Dnm2	A	T	9: 21,503,677	K677*	probably null	Het
Dscaml1	C	A	9: 45,668,224	N356K	possibly damaging	Het
Dvl3	A	G	16: 20,527,258	D446G	probably damaging	Het
Ecm2	A	G	13: 49,515,042	N74D	probably benign	Het
Ecm2	A	G	13: 49,527,740	I450M	probably damaging	Het
Emc1	T	A	4: 139,363,724	D460E	probably benign	Het
Fam160b2	T	C	14: 70,586,818	Y493C	probably benign	Het
Fuom	T	A	7: 140,099,915	E121V	possibly damaging	Het
Fyco1	T	C	9: 123,828,520	T864A	possibly damaging	Het
Galk2	T	C	2: 125,975,298	Y336H	probably damaging	Het
Gcsh	T	A	8: 116,993,386	Y14F	probably benign	Het
Grip1	G	A	10: 120,038,664	E778K	possibly damaging	Het
Gucy2g	T	C	19: 55,206,173	I937M	probably damaging	Het
Hsp90ab1	T	C	17: 45,569,674	I370M	possibly damaging	Het
Hypk	T	C	2: 121,457,673	S72P	probably damaging	Het
Izumo1r	T	G	9: 14,900,544	I183L	possibly damaging	Het
Kctd13	G	T	7: 126,945,008	G293C	probably damaging	Het
Kmt2d	CTGTTG	CTG	15: 98,845,176		probably benign	Het
Krt13	T	C	11: 100,121,492	S2G	probably benign	Het
Mark4	C	A	7: 19,433,413	R467L	possibly damaging	Het
Mrps33	T	A	6: 39,802,488	K91M	probably damaging	Het
Muc5ac	T	A	7: 141,796,341	V608D	possibly damaging	Het
Myb	G	A	10: 21,154,728	Q57*	probably null	Het
Olfr566	T	G	7: 102,856,940	H114P	probably damaging	Het
Peg10	GCAC	GCACCAC	6: 4,756,452		probably benign	Het
Phldb3	G	A	7: 24,628,947	V639M	probably damaging	Het
Pip4k2c	A	C	10: 127,200,200	L266R	probably damaging	Het
Plg	T	C	17: 12,390,326	Y173H	probably benign	Het
Pmp22	G	T	11: 63,133,239	V25F	probably benign	Het
Ppp1r16b	T	A	2: 158,696,078	Y40N	probably damaging	Het
Prl5a1	A	G	13: 28,145,509	E57G	possibly damaging	Het
Psmb10	A	G	8: 105,937,512	F75S	probably benign	Het
Ptprm	C	A	17: 66,693,488	R1167M	probably damaging	Het
Rbm46	T	C	3: 82,864,234	H358R	probably benign	Het
Rgl1	A	G	1: 152,521,364	S684P	probably benign	Het
Rmnd5b	T	C	11: 51,627,042	I162V	probably damaging	Het
Sh3d19	T	C	3: 86,107,222	V440A	possibly damaging	Het
Sik1	T	A	17: 31,854,272	K70M	probably damaging	Het
Slc44a4	C	T	17: 34,928,817	S611F	probably benign	Het
Stk32a	A	G	18: 43,297,555	I177V	probably benign	Het
Syt7	G	A	19: 10,444,095	D548N	probably benign	Het
Tcf7l2	A	G	19: 55,910,606	D215G	probably null	Het
Tex14	T	A	11: 87,486,258	F143I	probably damaging	Het
Tjp3	A	G	10: 81,283,577	V26A	possibly damaging	Het
Tpx2	T	A	2: 152,873,204	V115D	probably benign	Het
Tubb2b	C	A	13: 34,127,759	K350N	probably damaging	Het
Usf3	T	C	16: 44,216,573	V472A	probably benign	Het
Vps13b	G	T	15: 35,642,409	G1389V	possibly damaging	Het
Vps39	T	C	2: 120,342,004	R183G	probably damaging	Het
Wnk4	G	T	11: 101,268,424	E556*	probably null	Het
Xpo7	T	A	14: 70,688,177	E474V	probably benign	Het
Zbtb18	A	G	1: 177,447,775	R234G	probably null	Het
Zc3h14	T	A	12: 98,771,404	I50N	possibly damaging	Het
Zfat	A	G	15: 68,179,806	V713A	possibly damaging	Het
Zfp462	T	C	4: 55,009,545	S504P	possibly damaging	Het
Zmiz1	T	C	14: 25,650,598	V502A	probably benign	Het

Other mutations in Adamts19

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00156:Adamts19	APN	18	59024465	missense	probably damaging	1.00
IGL00331:Adamts19	APN	18	59007325	splice site	probably benign
IGL00970:Adamts19	APN	18	59011077	missense	possibly damaging	0.82
IGL01328:Adamts19	APN	18	59048882	missense	possibly damaging	0.89
IGL01385:Adamts19	APN	18	58972779	missense	probably damaging	0.98
IGL01529:Adamts19	APN	18	58963463	missense	probably damaging	0.99
IGL01535:Adamts19	APN	18	58968819	missense	probably benign	0.00
IGL01557:Adamts19	APN	18	58968720	splice site	probably null
IGL01705:Adamts19	APN	18	59032966	missense	possibly damaging	0.91
IGL01803:Adamts19	APN	18	58952469	missense	probably damaging	1.00
IGL02116:Adamts19	APN	18	58837499	missense	probably benign
IGL02131:Adamts19	APN	18	59052660	missense	probably damaging	1.00
IGL02312:Adamts19	APN	18	58927297	missense	probably damaging	1.00
IGL02755:Adamts19	APN	18	58969933	missense	probably benign	0.25
IGL02866:Adamts19	APN	18	59048842	missense	possibly damaging	0.80
IGL02964:Adamts19	APN	18	58988965	missense	probably damaging	1.00
IGL02982:Adamts19	APN	18	59024518	missense	probably damaging	1.00
IGL03040:Adamts19	APN	18	58903008	missense	probably benign	0.05
R0081:Adamts19	UTSW	18	58903065	critical splice donor site	probably null
R0194:Adamts19	UTSW	18	59011148	missense	probably null	1.00
R0195:Adamts19	UTSW	18	58969870	splice site	probably benign
R0541:Adamts19	UTSW	18	58927300	critical splice donor site	probably null
R0659:Adamts19	UTSW	18	59007493	splice site	probably benign
R0967:Adamts19	UTSW	18	58972740	nonsense	probably null
R1512:Adamts19	UTSW	18	59048845	missense	possibly damaging	0.89
R1536:Adamts19	UTSW	18	59052615	missense	probably damaging	1.00
R1582:Adamts19	UTSW	18	58969941	missense	probably damaging	0.98
R1629:Adamts19	UTSW	18	58954619	missense	probably damaging	0.97
R1653:Adamts19	UTSW	18	58890293	missense	probably benign	0.00
R1718:Adamts19	UTSW	18	58972825	missense	probably damaging	1.00
R1733:Adamts19	UTSW	18	59031929	missense	probably damaging	1.00
R1753:Adamts19	UTSW	18	59007372	missense	possibly damaging	0.78
R1776:Adamts19	UTSW	18	58954620	missense	probably damaging	1.00
R1905:Adamts19	UTSW	18	59032945	missense	possibly damaging	0.92
R1958:Adamts19	UTSW	18	58970006	missense	probably benign	0.09
R1994:Adamts19	UTSW	18	58972831	critical splice donor site	probably null
R2177:Adamts19	UTSW	18	58954554	missense	possibly damaging	0.66
R3730:Adamts19	UTSW	18	58900910	missense	probably damaging	1.00
R4342:Adamts19	UTSW	18	58942500	missense	probably damaging	1.00
R4772:Adamts19	UTSW	18	58837776	missense	possibly damaging	0.85
R4822:Adamts19	UTSW	18	58890284	missense	probably damaging	1.00
R4891:Adamts19	UTSW	18	59033000	missense	probably damaging	1.00
R5112:Adamts19	UTSW	18	59031804	nonsense	probably null
R5116:Adamts19	UTSW	18	58902994	missense	possibly damaging	0.52
R5205:Adamts19	UTSW	18	58968808	missense	probably damaging	1.00
R5765:Adamts19	UTSW	18	59052582	missense	probably damaging	1.00
R5781:Adamts19	UTSW	18	58837968	missense	possibly damaging	0.59
R5792:Adamts19	UTSW	18	58837512	missense	possibly damaging	0.49
R6082:Adamts19	UTSW	18	58968774	missense	probably benign	0.18
R6088:Adamts19	UTSW	18	58902102	missense	probably damaging	1.00
R7060:Adamts19	UTSW	18	58837640	nonsense	probably null
R7251:Adamts19	UTSW	18	58837902	missense	probably damaging	1.00
R7295:Adamts19	UTSW	18	58837883	missense	probably damaging	1.00
R7974:Adamts19	UTSW	18	59011022	missense	possibly damaging	0.72
R7991:Adamts19	UTSW	18	59052654	missense	probably damaging	1.00
R8129:Adamts19	UTSW	18	59007487	critical splice donor site	probably null
R8297:Adamts19	UTSW	18	58837848	missense	probably damaging	1.00
R8336:Adamts19	UTSW	18	59007372	missense	possibly damaging	0.78
R8358:Adamts19	UTSW	18	59048809	missense	probably damaging	1.00
R8864:Adamts19	UTSW	18	58890425	nonsense	probably null
R9051:Adamts19	UTSW	18	58900976	missense	probably damaging	1.00
R9253:Adamts19	UTSW	18	58969941	missense	probably damaging	0.98
R9423:Adamts19	UTSW	18	58890355	missense	possibly damaging	0.89
R9611:Adamts19	UTSW	18	58890327	missense	probably benign	0.26
R9686:Adamts19	UTSW	18	58838021	missense	probably benign	0.00
R9697:Adamts19	UTSW	18	58968762	missense	probably damaging	0.99
R9747:Adamts19	UTSW	18	58890415	missense	possibly damaging	0.69
Z1177:Adamts19	UTSW	18	58838075	missense	probably damaging	1.00
Z1177:Adamts19	UTSW	18	58890374	missense	possibly damaging	0.47

Predicted Primers

PCR Primer
(F):5'- ACTATGAGAAGGTGGCTGGC -3'
(R):5'- GCGGAGACAGTGTTTCTAAGAATTC -3'

Sequencing Primer
(F):5'- CAAAGAGTTCGTGTGCACATTCG -3'
(R):5'- GAATTCACTTCCTACTTCACACAGAG -3'

Posted On

2022-09-12