Incidental Mutation 'R9611:Colgalt2'
ID 724196
Institutional Source Beutler Lab
Gene Symbol Colgalt2
Ensembl Gene ENSMUSG00000032649
Gene Name collagen beta(1-O)galactosyltransferase 2
Synonyms Glt25d2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock # R9611 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 152399830-152510695 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 152484994 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Arginine at position 261 (W261R)
Ref Sequence ENSEMBL: ENSMUSP00000037532 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044311] [ENSMUST00000127586]
AlphaFold Q6NVG7
Predicted Effect probably damaging
Transcript: ENSMUST00000044311
AA Change: W261R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000037532
Gene: ENSMUSG00000032649
AA Change: W261R

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Glyco_tranf_2_4 61 181 1.3e-20 PFAM
Pfam:Glyco_transf_25 340 525 5.8e-41 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000127586
AA Change: W261R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119210
Gene: ENSMUSG00000032649
AA Change: W261R

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Glyco_tranf_2_4 61 181 4.3e-17 PFAM
Pfam:Glyco_transf_25 340 466 3.2e-37 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110051M20Rik T C 2: 91,304,782 D111G probably damaging Het
Adamts19 A T 18: 58,890,327 T265S probably benign Het
Ahnak T A 19: 9,011,798 L3482Q probably damaging Het
Apopt1 T G 12: 111,733,674 Y163D probably damaging Het
Arhgef5 A G 6: 43,280,956 I1311M probably damaging Het
Bcr T A 10: 75,154,911 Y750N probably damaging Het
Bcr T A 10: 75,154,913 Y750* probably null Het
Btbd16 T A 7: 130,805,865 M295K probably benign Het
Ccdc88a T C 11: 29,477,316 L1007P possibly damaging Het
Cnep1r1 A G 8: 88,133,829 *126W probably null Het
Cntnap5b C A 1: 99,967,210 P69Q probably damaging Het
Col4a3 A G 1: 82,700,297 M1207V unknown Het
Cstf1 T A 2: 172,373,064 I35N probably benign Het
Cul9 A G 17: 46,519,897 L1690P possibly damaging Het
Dscaml1 C A 9: 45,668,224 N356K possibly damaging Het
Ecm2 A G 13: 49,515,042 N74D probably benign Het
Ecm2 A G 13: 49,527,740 I450M probably damaging Het
Emc1 T A 4: 139,363,724 D460E probably benign Het
Fam160b2 T C 14: 70,586,818 Y493C probably benign Het
Fmo5 C T 3: 97,641,773 R246C possibly damaging Het
Fyco1 T C 9: 123,828,520 T864A possibly damaging Het
Galk2 T C 2: 125,975,298 Y336H probably damaging Het
Gcsh T A 8: 116,993,386 Y14F probably benign Het
Grip1 G A 10: 120,038,664 E778K possibly damaging Het
Gucy2g T C 19: 55,206,173 I937M probably damaging Het
Hsp90ab1 T C 17: 45,569,674 I370M possibly damaging Het
Hypk T C 2: 121,457,673 S72P probably damaging Het
Ighv1-26 T C 12: 114,788,586 Y46C probably damaging Het
Kctd13 G T 7: 126,945,008 G293C probably damaging Het
Kmt2d CTGCTGTTGCTG CTGCTG 15: 98,845,173 probably benign Het
Kmt2d CTGTTG CTG 15: 98,845,176 probably benign Het
Krt13 T C 11: 100,121,492 S2G probably benign Het
Mark4 C A 7: 19,433,413 R467L possibly damaging Het
Mrps33 T A 6: 39,802,488 K91M probably damaging Het
Olfr209 A C 16: 59,361,879 I113S probably benign Het
Olfr566 T G 7: 102,856,940 H114P probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Peg10 C CTCA 6: 4,756,453 probably benign Het
Phldb3 G A 7: 24,628,947 V639M probably damaging Het
Pigyl A T 9: 22,158,203 H70L probably damaging Het
Pip4k2c A C 10: 127,200,200 L266R probably damaging Het
Plg T C 17: 12,390,326 Y173H probably benign Het
Pmp22 G T 11: 63,133,239 V25F probably benign Het
Pot1b T A 17: 55,699,995 T41S probably benign Het
Ppp1r16b T A 2: 158,696,078 Y40N probably damaging Het
Prl5a1 A G 13: 28,145,509 E57G possibly damaging Het
Prpf3 G A 3: 95,851,619 R74* probably null Het
Psmb10 A G 8: 105,937,512 F75S probably benign Het
Ptprm C A 17: 66,693,488 R1167M probably damaging Het
Rmnd5b T C 11: 51,627,042 I162V probably damaging Het
Sik1 T A 17: 31,854,272 K70M probably damaging Het
Slc44a4 C T 17: 34,928,817 S611F probably benign Het
St18 T C 1: 6,802,923 V294A probably benign Het
Stk32a A G 18: 43,297,555 I177V probably benign Het
Syne2 T C 12: 76,033,686 F58S probably benign Het
Tcf7l2 A G 19: 55,910,606 D215G probably null Het
Tcirg1 A T 19: 3,903,400 F149Y probably benign Het
Tex14 T A 11: 87,486,258 F143I probably damaging Het
Tjp3 A G 10: 81,283,577 V26A possibly damaging Het
Tnfaip8 ACACACTCTC AC 18: 50,046,841 probably benign Het
Tpx2 T A 2: 152,873,204 V115D probably benign Het
Tubb2b C A 13: 34,127,759 K350N probably damaging Het
Vps13b G T 15: 35,642,409 G1389V possibly damaging Het
Vps39 T C 2: 120,342,004 R183G probably damaging Het
Wdr47 A T 3: 108,611,413 E72D probably damaging Het
Wnk4 G T 11: 101,268,424 E556* probably null Het
Xpo7 T A 14: 70,688,177 E474V probably benign Het
Zfat A G 15: 68,179,806 V713A possibly damaging Het
Zfp189 G T 4: 49,530,058 C387F probably damaging Het
Zmiz1 T C 14: 25,650,598 V502A probably benign Het
Other mutations in Colgalt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01472:Colgalt2 APN 1 152506878 missense probably damaging 0.98
IGL02900:Colgalt2 APN 1 152508730 missense probably damaging 0.99
R0280:Colgalt2 UTSW 1 152508561 missense possibly damaging 0.68
R0282:Colgalt2 UTSW 1 152508561 missense possibly damaging 0.68
R0328:Colgalt2 UTSW 1 152473108 missense probably damaging 1.00
R0409:Colgalt2 UTSW 1 152508561 missense possibly damaging 0.68
R0412:Colgalt2 UTSW 1 152508561 missense possibly damaging 0.68
R0485:Colgalt2 UTSW 1 152484871 missense probably damaging 1.00
R0518:Colgalt2 UTSW 1 152508561 missense possibly damaging 0.68
R0519:Colgalt2 UTSW 1 152508561 missense possibly damaging 0.68
R0556:Colgalt2 UTSW 1 152471813 splice site probably benign
R0605:Colgalt2 UTSW 1 152495792 splice site probably benign
R0628:Colgalt2 UTSW 1 152508561 missense possibly damaging 0.68
R0972:Colgalt2 UTSW 1 152471744 missense probably damaging 1.00
R1170:Colgalt2 UTSW 1 152503017 missense probably damaging 1.00
R1373:Colgalt2 UTSW 1 152473161 missense probably damaging 1.00
R1452:Colgalt2 UTSW 1 152504153 missense probably damaging 1.00
R1456:Colgalt2 UTSW 1 152484904 missense probably damaging 1.00
R1544:Colgalt2 UTSW 1 152484952 missense probably damaging 1.00
R1707:Colgalt2 UTSW 1 152400363 missense probably damaging 1.00
R2285:Colgalt2 UTSW 1 152468550 missense probably benign 0.00
R2917:Colgalt2 UTSW 1 152471744 missense probably damaging 1.00
R3916:Colgalt2 UTSW 1 152508611 nonsense probably null
R3917:Colgalt2 UTSW 1 152508611 nonsense probably null
R4250:Colgalt2 UTSW 1 152489887 missense probably benign 0.00
R4282:Colgalt2 UTSW 1 152468531 missense probably damaging 1.00
R4421:Colgalt2 UTSW 1 152485012 missense probably damaging 0.99
R4583:Colgalt2 UTSW 1 152506876 missense probably damaging 1.00
R4743:Colgalt2 UTSW 1 152400343 missense probably damaging 0.97
R4751:Colgalt2 UTSW 1 152489876 missense probably benign 0.34
R4832:Colgalt2 UTSW 1 152484998 missense possibly damaging 0.87
R4930:Colgalt2 UTSW 1 152499959 missense possibly damaging 0.92
R5319:Colgalt2 UTSW 1 152484869 missense possibly damaging 0.78
R5504:Colgalt2 UTSW 1 152400303 missense possibly damaging 0.88
R5916:Colgalt2 UTSW 1 152504122 missense probably damaging 1.00
R6006:Colgalt2 UTSW 1 152473161 missense probably damaging 1.00
R6362:Colgalt2 UTSW 1 152471798 missense probably damaging 1.00
R6837:Colgalt2 UTSW 1 152506828 missense probably damaging 1.00
R7464:Colgalt2 UTSW 1 152504144 missense probably damaging 0.97
R8462:Colgalt2 UTSW 1 152503072 missense probably damaging 1.00
R8725:Colgalt2 UTSW 1 152484911 missense probably damaging 0.99
R8727:Colgalt2 UTSW 1 152484911 missense probably damaging 0.99
R9118:Colgalt2 UTSW 1 152503155 intron probably benign
R9186:Colgalt2 UTSW 1 152508652 missense probably damaging 0.98
R9393:Colgalt2 UTSW 1 152484847 nonsense probably null
X0028:Colgalt2 UTSW 1 152471720 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGATGCCTGGATAATGATGCC -3'
(R):5'- GGTTACTACAAGCACCTCAATG -3'

Sequencing Primer
(F):5'- CCTTCAGATGAGAGGACATGGTCTC -3'
(R):5'- GCCTCTAACGGACTTGAAATTGAG -3'
Posted On 2022-09-12