Incidental Mutation 'R9611:Colgalt2'
ID 724196
Institutional Source Beutler Lab
Gene Symbol Colgalt2
Ensembl Gene ENSMUSG00000032649
Gene Name collagen beta(1-O)galactosyltransferase 2
Synonyms Glt25d2
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.061) question?
Stock # R9611 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 152275581-152386446 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 152360745 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Arginine at position 261 (W261R)
Ref Sequence ENSEMBL: ENSMUSP00000037532 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044311] [ENSMUST00000127586]
AlphaFold Q6NVG7
Predicted Effect probably damaging
Transcript: ENSMUST00000044311
AA Change: W261R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000037532
Gene: ENSMUSG00000032649
AA Change: W261R

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Glyco_tranf_2_4 61 181 1.3e-20 PFAM
Pfam:Glyco_transf_25 340 525 5.8e-41 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000127586
AA Change: W261R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119210
Gene: ENSMUSG00000032649
AA Change: W261R

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Glyco_tranf_2_4 61 181 4.3e-17 PFAM
Pfam:Glyco_transf_25 340 466 3.2e-37 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts19 A T 18: 59,023,399 (GRCm39) T265S probably benign Het
Ahnak T A 19: 8,989,162 (GRCm39) L3482Q probably damaging Het
Arhgef5 A G 6: 43,257,890 (GRCm39) I1311M probably damaging Het
Bcr T A 10: 74,990,743 (GRCm39) Y750N probably damaging Het
Bcr T A 10: 74,990,745 (GRCm39) Y750* probably null Het
Btbd16 T A 7: 130,407,595 (GRCm39) M295K probably benign Het
Ccdc88a T C 11: 29,427,316 (GRCm39) L1007P possibly damaging Het
Cnep1r1 A G 8: 88,860,457 (GRCm39) *126W probably null Het
Cntnap5b C A 1: 99,894,935 (GRCm39) P69Q probably damaging Het
Coa8 T G 12: 111,700,108 (GRCm39) Y163D probably damaging Het
Col4a3 A G 1: 82,678,018 (GRCm39) M1207V unknown Het
Cstf1 T A 2: 172,214,984 (GRCm39) I35N probably benign Het
Cstpp1 T C 2: 91,135,127 (GRCm39) D111G probably damaging Het
Cul9 A G 17: 46,830,823 (GRCm39) L1690P possibly damaging Het
Dscaml1 C A 9: 45,579,522 (GRCm39) N356K possibly damaging Het
Ecm2 A G 13: 49,668,518 (GRCm39) N74D probably benign Het
Ecm2 A G 13: 49,681,216 (GRCm39) I450M probably damaging Het
Emc1 T A 4: 139,091,035 (GRCm39) D460E probably benign Het
Fhip2b T C 14: 70,824,258 (GRCm39) Y493C probably benign Het
Fmo5 C T 3: 97,549,089 (GRCm39) R246C possibly damaging Het
Fyco1 T C 9: 123,657,585 (GRCm39) T864A possibly damaging Het
Galk2 T C 2: 125,817,218 (GRCm39) Y336H probably damaging Het
Gcsh T A 8: 117,720,125 (GRCm39) Y14F probably benign Het
Grip1 G A 10: 119,874,569 (GRCm39) E778K possibly damaging Het
Gucy2g T C 19: 55,194,605 (GRCm39) I937M probably damaging Het
Hsp90ab1 T C 17: 45,880,600 (GRCm39) I370M possibly damaging Het
Hypk T C 2: 121,288,154 (GRCm39) S72P probably damaging Het
Ighv1-26 T C 12: 114,752,206 (GRCm39) Y46C probably damaging Het
Kctd13 G T 7: 126,544,180 (GRCm39) G293C probably damaging Het
Kmt2d CTGCTGTTGCTG CTGCTG 15: 98,743,054 (GRCm39) probably benign Het
Kmt2d CTGTTG CTG 15: 98,743,057 (GRCm39) probably benign Het
Krt13 T C 11: 100,012,318 (GRCm39) S2G probably benign Het
Mark4 C A 7: 19,167,338 (GRCm39) R467L possibly damaging Het
Mrps33 T A 6: 39,779,422 (GRCm39) K91M probably damaging Het
Or51f1 T G 7: 102,506,147 (GRCm39) H114P probably damaging Het
Or5ac25 A C 16: 59,182,242 (GRCm39) I113S probably benign Het
Peg10 GC GCTCC 6: 4,756,452 (GRCm39) probably benign Het
Peg10 C CTCA 6: 4,756,453 (GRCm39) probably benign Het
Phldb3 G A 7: 24,328,372 (GRCm39) V639M probably damaging Het
Pigyl A T 9: 22,069,499 (GRCm39) H70L probably damaging Het
Pip4k2c A C 10: 127,036,069 (GRCm39) L266R probably damaging Het
Plg T C 17: 12,609,213 (GRCm39) Y173H probably benign Het
Pmp22 G T 11: 63,024,065 (GRCm39) V25F probably benign Het
Pot1b T A 17: 56,006,995 (GRCm39) T41S probably benign Het
Ppp1r16b T A 2: 158,537,998 (GRCm39) Y40N probably damaging Het
Prl5a1 A G 13: 28,329,492 (GRCm39) E57G possibly damaging Het
Prpf3 G A 3: 95,758,931 (GRCm39) R74* probably null Het
Psmb10 A G 8: 106,664,144 (GRCm39) F75S probably benign Het
Ptprm C A 17: 67,000,483 (GRCm39) R1167M probably damaging Het
Rmnd5b T C 11: 51,517,869 (GRCm39) I162V probably damaging Het
Sik1 T A 17: 32,073,246 (GRCm39) K70M probably damaging Het
Slc44a4 C T 17: 35,147,793 (GRCm39) S611F probably benign Het
St18 T C 1: 6,873,147 (GRCm39) V294A probably benign Het
Stk32a A G 18: 43,430,620 (GRCm39) I177V probably benign Het
Syne2 T C 12: 76,080,460 (GRCm39) F58S probably benign Het
Tcf7l2 A G 19: 55,899,038 (GRCm39) D215G probably null Het
Tcirg1 A T 19: 3,953,400 (GRCm39) F149Y probably benign Het
Tex14 T A 11: 87,377,084 (GRCm39) F143I probably damaging Het
Tjp3 A G 10: 81,119,411 (GRCm39) V26A possibly damaging Het
Tnfaip8 ACACACTCTC AC 18: 50,179,908 (GRCm39) probably benign Het
Tpx2 T A 2: 152,715,124 (GRCm39) V115D probably benign Het
Tubb2b C A 13: 34,311,742 (GRCm39) K350N probably damaging Het
Vps13b G T 15: 35,642,555 (GRCm39) G1389V possibly damaging Het
Vps39 T C 2: 120,172,485 (GRCm39) R183G probably damaging Het
Wdr47 A T 3: 108,518,729 (GRCm39) E72D probably damaging Het
Wnk4 G T 11: 101,159,250 (GRCm39) E556* probably null Het
Xpo7 T A 14: 70,925,617 (GRCm39) E474V probably benign Het
Zfat A G 15: 68,051,655 (GRCm39) V713A possibly damaging Het
Zfp189 G T 4: 49,530,058 (GRCm39) C387F probably damaging Het
Zmiz1 T C 14: 25,651,022 (GRCm39) V502A probably benign Het
Other mutations in Colgalt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01472:Colgalt2 APN 1 152,382,629 (GRCm39) missense probably damaging 0.98
IGL02900:Colgalt2 APN 1 152,384,481 (GRCm39) missense probably damaging 0.99
R0280:Colgalt2 UTSW 1 152,384,312 (GRCm39) missense possibly damaging 0.68
R0282:Colgalt2 UTSW 1 152,384,312 (GRCm39) missense possibly damaging 0.68
R0328:Colgalt2 UTSW 1 152,348,859 (GRCm39) missense probably damaging 1.00
R0409:Colgalt2 UTSW 1 152,384,312 (GRCm39) missense possibly damaging 0.68
R0412:Colgalt2 UTSW 1 152,384,312 (GRCm39) missense possibly damaging 0.68
R0485:Colgalt2 UTSW 1 152,360,622 (GRCm39) missense probably damaging 1.00
R0518:Colgalt2 UTSW 1 152,384,312 (GRCm39) missense possibly damaging 0.68
R0519:Colgalt2 UTSW 1 152,384,312 (GRCm39) missense possibly damaging 0.68
R0556:Colgalt2 UTSW 1 152,347,564 (GRCm39) splice site probably benign
R0605:Colgalt2 UTSW 1 152,371,543 (GRCm39) splice site probably benign
R0628:Colgalt2 UTSW 1 152,384,312 (GRCm39) missense possibly damaging 0.68
R0972:Colgalt2 UTSW 1 152,347,495 (GRCm39) missense probably damaging 1.00
R1170:Colgalt2 UTSW 1 152,378,768 (GRCm39) missense probably damaging 1.00
R1373:Colgalt2 UTSW 1 152,348,912 (GRCm39) missense probably damaging 1.00
R1452:Colgalt2 UTSW 1 152,379,904 (GRCm39) missense probably damaging 1.00
R1456:Colgalt2 UTSW 1 152,360,655 (GRCm39) missense probably damaging 1.00
R1544:Colgalt2 UTSW 1 152,360,703 (GRCm39) missense probably damaging 1.00
R1707:Colgalt2 UTSW 1 152,276,114 (GRCm39) missense probably damaging 1.00
R2285:Colgalt2 UTSW 1 152,344,301 (GRCm39) missense probably benign 0.00
R2917:Colgalt2 UTSW 1 152,347,495 (GRCm39) missense probably damaging 1.00
R3916:Colgalt2 UTSW 1 152,384,362 (GRCm39) nonsense probably null
R3917:Colgalt2 UTSW 1 152,384,362 (GRCm39) nonsense probably null
R4250:Colgalt2 UTSW 1 152,365,638 (GRCm39) missense probably benign 0.00
R4282:Colgalt2 UTSW 1 152,344,282 (GRCm39) missense probably damaging 1.00
R4421:Colgalt2 UTSW 1 152,360,763 (GRCm39) missense probably damaging 0.99
R4583:Colgalt2 UTSW 1 152,382,627 (GRCm39) missense probably damaging 1.00
R4743:Colgalt2 UTSW 1 152,276,094 (GRCm39) missense probably damaging 0.97
R4751:Colgalt2 UTSW 1 152,365,627 (GRCm39) missense probably benign 0.34
R4832:Colgalt2 UTSW 1 152,360,749 (GRCm39) missense possibly damaging 0.87
R4930:Colgalt2 UTSW 1 152,375,710 (GRCm39) missense possibly damaging 0.92
R5319:Colgalt2 UTSW 1 152,360,620 (GRCm39) missense possibly damaging 0.78
R5504:Colgalt2 UTSW 1 152,276,054 (GRCm39) missense possibly damaging 0.88
R5916:Colgalt2 UTSW 1 152,379,873 (GRCm39) missense probably damaging 1.00
R6006:Colgalt2 UTSW 1 152,348,912 (GRCm39) missense probably damaging 1.00
R6362:Colgalt2 UTSW 1 152,347,549 (GRCm39) missense probably damaging 1.00
R6837:Colgalt2 UTSW 1 152,382,579 (GRCm39) missense probably damaging 1.00
R7464:Colgalt2 UTSW 1 152,379,895 (GRCm39) missense probably damaging 0.97
R8462:Colgalt2 UTSW 1 152,378,823 (GRCm39) missense probably damaging 1.00
R8725:Colgalt2 UTSW 1 152,360,662 (GRCm39) missense probably damaging 0.99
R8727:Colgalt2 UTSW 1 152,360,662 (GRCm39) missense probably damaging 0.99
R9118:Colgalt2 UTSW 1 152,378,906 (GRCm39) intron probably benign
R9186:Colgalt2 UTSW 1 152,384,403 (GRCm39) missense probably damaging 0.98
R9393:Colgalt2 UTSW 1 152,360,598 (GRCm39) nonsense probably null
X0028:Colgalt2 UTSW 1 152,347,471 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGATGCCTGGATAATGATGCC -3'
(R):5'- GGTTACTACAAGCACCTCAATG -3'

Sequencing Primer
(F):5'- CCTTCAGATGAGAGGACATGGTCTC -3'
(R):5'- GCCTCTAACGGACTTGAAATTGAG -3'
Posted On 2022-09-12