Incidental Mutation 'R9611:Emc1'
ID 724208
Institutional Source Beutler Lab
Gene Symbol Emc1
Ensembl Gene ENSMUSG00000078517
Gene Name ER membrane protein complex subunit 1
Synonyms C230096C10Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.967) question?
Stock # R9611 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 139352587-139378730 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 139363724 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 460 (D460E)
Ref Sequence ENSEMBL: ENSMUSP00000080888 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042096] [ENSMUST00000082262] [ENSMUST00000147999] [ENSMUST00000155700] [ENSMUST00000179784]
AlphaFold Q8C7X2
Predicted Effect possibly damaging
Transcript: ENSMUST00000042096
AA Change: D460E

PolyPhen 2 Score 0.458 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000049034
Gene: ENSMUSG00000078517
AA Change: D460E

DomainStartEndE-ValueType
Pfam:PQQ_2 21 258 5.3e-9 PFAM
Pfam:DUF1620 787 993 1.1e-66 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000082262
AA Change: D460E

PolyPhen 2 Score 0.377 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000080888
Gene: ENSMUSG00000078517
AA Change: D460E

DomainStartEndE-ValueType
Pfam:PQQ_2 21 258 4.7e-10 PFAM
Pfam:DUF1620 791 996 1.1e-77 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147999
SMART Domains Protein: ENSMUSP00000117419
Gene: ENSMUSG00000066036

DomainStartEndE-ValueType
low complexity region 170 226 N/A INTRINSIC
low complexity region 617 629 N/A INTRINSIC
Pfam:E3_UbLigase_R4 1205 1301 4.5e-60 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000155700
AA Change: D287E

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Predicted Effect probably benign
Transcript: ENSMUST00000179784
AA Change: D460E

PolyPhen 2 Score 0.208 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000137103
Gene: ENSMUSG00000078517
AA Change: D460E

DomainStartEndE-ValueType
Pfam:PQQ_2 21 258 5.3e-9 PFAM
Pfam:DUF1620 790 996 1.1e-66 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a single-pass type I transmembrane protein, which is a subunit of the endoplasmic reticulum membrane protein complex (EMC). Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2012]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110051M20Rik T C 2: 91,304,782 D111G probably damaging Het
Adamts19 A T 18: 58,890,327 T265S probably benign Het
Ahnak T A 19: 9,011,798 L3482Q probably damaging Het
Apopt1 T G 12: 111,733,674 Y163D probably damaging Het
Arhgef5 A G 6: 43,280,956 I1311M probably damaging Het
Bcr T A 10: 75,154,911 Y750N probably damaging Het
Bcr T A 10: 75,154,913 Y750* probably null Het
Btbd16 T A 7: 130,805,865 M295K probably benign Het
Ccdc88a T C 11: 29,477,316 L1007P possibly damaging Het
Cnep1r1 A G 8: 88,133,829 *126W probably null Het
Cntnap5b C A 1: 99,967,210 P69Q probably damaging Het
Col4a3 A G 1: 82,700,297 M1207V unknown Het
Colgalt2 T A 1: 152,484,994 W261R probably damaging Het
Cstf1 T A 2: 172,373,064 I35N probably benign Het
Cul9 A G 17: 46,519,897 L1690P possibly damaging Het
Dscaml1 C A 9: 45,668,224 N356K possibly damaging Het
Ecm2 A G 13: 49,527,740 I450M probably damaging Het
Ecm2 A G 13: 49,515,042 N74D probably benign Het
Fam160b2 T C 14: 70,586,818 Y493C probably benign Het
Fmo5 C T 3: 97,641,773 R246C possibly damaging Het
Fyco1 T C 9: 123,828,520 T864A possibly damaging Het
Galk2 T C 2: 125,975,298 Y336H probably damaging Het
Gcsh T A 8: 116,993,386 Y14F probably benign Het
Grip1 G A 10: 120,038,664 E778K possibly damaging Het
Gucy2g T C 19: 55,206,173 I937M probably damaging Het
Hsp90ab1 T C 17: 45,569,674 I370M possibly damaging Het
Hypk T C 2: 121,457,673 S72P probably damaging Het
Ighv1-26 T C 12: 114,788,586 Y46C probably damaging Het
Kctd13 G T 7: 126,945,008 G293C probably damaging Het
Kmt2d CTGCTGTTGCTG CTGCTG 15: 98,845,173 probably benign Het
Kmt2d CTGTTG CTG 15: 98,845,176 probably benign Het
Krt13 T C 11: 100,121,492 S2G probably benign Het
Mark4 C A 7: 19,433,413 R467L possibly damaging Het
Mrps33 T A 6: 39,802,488 K91M probably damaging Het
Olfr209 A C 16: 59,361,879 I113S probably benign Het
Olfr566 T G 7: 102,856,940 H114P probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Peg10 C CTCA 6: 4,756,453 probably benign Het
Phldb3 G A 7: 24,628,947 V639M probably damaging Het
Pigyl A T 9: 22,158,203 H70L probably damaging Het
Pip4k2c A C 10: 127,200,200 L266R probably damaging Het
Plg T C 17: 12,390,326 Y173H probably benign Het
Pmp22 G T 11: 63,133,239 V25F probably benign Het
Pot1b T A 17: 55,699,995 T41S probably benign Het
Ppp1r16b T A 2: 158,696,078 Y40N probably damaging Het
Prl5a1 A G 13: 28,145,509 E57G possibly damaging Het
Prpf3 G A 3: 95,851,619 R74* probably null Het
Psmb10 A G 8: 105,937,512 F75S probably benign Het
Ptprm C A 17: 66,693,488 R1167M probably damaging Het
Rmnd5b T C 11: 51,627,042 I162V probably damaging Het
Sik1 T A 17: 31,854,272 K70M probably damaging Het
Slc44a4 C T 17: 34,928,817 S611F probably benign Het
St18 T C 1: 6,802,923 V294A probably benign Het
Stk32a A G 18: 43,297,555 I177V probably benign Het
Syne2 T C 12: 76,033,686 F58S probably benign Het
Tcf7l2 A G 19: 55,910,606 D215G probably null Het
Tcirg1 A T 19: 3,903,400 F149Y probably benign Het
Tex14 T A 11: 87,486,258 F143I probably damaging Het
Tjp3 A G 10: 81,283,577 V26A possibly damaging Het
Tnfaip8 ACACACTCTC AC 18: 50,046,841 probably benign Het
Tpx2 T A 2: 152,873,204 V115D probably benign Het
Tubb2b C A 13: 34,127,759 K350N probably damaging Het
Vps13b G T 15: 35,642,409 G1389V possibly damaging Het
Vps39 T C 2: 120,342,004 R183G probably damaging Het
Wdr47 A T 3: 108,611,413 E72D probably damaging Het
Wnk4 G T 11: 101,268,424 E556* probably null Het
Xpo7 T A 14: 70,688,177 E474V probably benign Het
Zfat A G 15: 68,179,806 V713A possibly damaging Het
Zfp189 G T 4: 49,530,058 C387F probably damaging Het
Zmiz1 T C 14: 25,650,598 V502A probably benign Het
Other mutations in Emc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Emc1 APN 4 139355082 splice site probably benign
IGL00898:Emc1 APN 4 139371630 missense probably damaging 1.00
IGL01481:Emc1 APN 4 139362099 missense probably benign 0.00
IGL02174:Emc1 APN 4 139371668 missense possibly damaging 0.95
IGL02264:Emc1 APN 4 139375464 missense probably damaging 1.00
IGL02501:Emc1 APN 4 139370984 missense probably benign 0.00
IGL02697:Emc1 APN 4 139352644 missense probably benign
IGL03355:Emc1 APN 4 139371593 splice site probably benign
IGL03386:Emc1 APN 4 139363781 critical splice donor site probably null
PIT4480001:Emc1 UTSW 4 139359277 missense possibly damaging 0.69
R0023:Emc1 UTSW 4 139371009 missense probably damaging 1.00
R0023:Emc1 UTSW 4 139371009 missense probably damaging 1.00
R0051:Emc1 UTSW 4 139375163 missense possibly damaging 0.81
R0094:Emc1 UTSW 4 139360485 missense probably damaging 0.99
R0613:Emc1 UTSW 4 139375072 splice site probably benign
R1464:Emc1 UTSW 4 139370937 missense probably damaging 0.97
R1464:Emc1 UTSW 4 139370937 missense probably damaging 0.97
R1512:Emc1 UTSW 4 139360184 splice site probably null
R1702:Emc1 UTSW 4 139375201 missense probably damaging 1.00
R1839:Emc1 UTSW 4 139360485 missense probably damaging 0.98
R1843:Emc1 UTSW 4 139375512 missense probably benign 0.02
R1850:Emc1 UTSW 4 139359373 splice site probably benign
R2024:Emc1 UTSW 4 139360946 missense possibly damaging 0.95
R2196:Emc1 UTSW 4 139366530 missense probably benign 0.08
R2912:Emc1 UTSW 4 139365260 missense possibly damaging 0.51
R3696:Emc1 UTSW 4 139365386 missense possibly damaging 0.46
R3697:Emc1 UTSW 4 139365386 missense possibly damaging 0.46
R3698:Emc1 UTSW 4 139365386 missense possibly damaging 0.46
R3803:Emc1 UTSW 4 139367163 missense possibly damaging 0.91
R3923:Emc1 UTSW 4 139363185 nonsense probably null
R4738:Emc1 UTSW 4 139362202 missense possibly damaging 0.52
R4914:Emc1 UTSW 4 139375165 nonsense probably null
R5033:Emc1 UTSW 4 139371696 missense probably damaging 1.00
R5322:Emc1 UTSW 4 139354246 missense probably damaging 1.00
R5375:Emc1 UTSW 4 139366491 missense probably damaging 0.96
R5483:Emc1 UTSW 4 139375376 missense probably damaging 1.00
R5587:Emc1 UTSW 4 139362148 missense probably damaging 0.98
R5687:Emc1 UTSW 4 139375380 missense probably damaging 1.00
R5938:Emc1 UTSW 4 139357620 missense probably benign
R6056:Emc1 UTSW 4 139354222 missense possibly damaging 0.51
R6170:Emc1 UTSW 4 139366378 missense probably benign 0.01
R6174:Emc1 UTSW 4 139366531 missense probably benign 0.01
R6208:Emc1 UTSW 4 139354271 missense probably damaging 0.99
R6340:Emc1 UTSW 4 139365563 missense probably damaging 1.00
R6371:Emc1 UTSW 4 139371665 nonsense probably null
R6889:Emc1 UTSW 4 139365350 missense probably damaging 0.97
R7592:Emc1 UTSW 4 139360566 missense probably benign 0.00
R7699:Emc1 UTSW 4 139354870 missense probably benign
R7715:Emc1 UTSW 4 139371623 missense probably damaging 1.00
R7984:Emc1 UTSW 4 139375449 missense probably damaging 1.00
R8112:Emc1 UTSW 4 139367187 missense probably benign 0.00
R8325:Emc1 UTSW 4 139365210 missense possibly damaging 0.94
R8387:Emc1 UTSW 4 139361289 missense probably benign
R8751:Emc1 UTSW 4 139369968 missense possibly damaging 0.58
R9032:Emc1 UTSW 4 139367163 missense possibly damaging 0.91
R9085:Emc1 UTSW 4 139367163 missense possibly damaging 0.91
R9474:Emc1 UTSW 4 139366394 missense probably damaging 0.98
R9482:Emc1 UTSW 4 139360890 missense probably damaging 0.96
R9610:Emc1 UTSW 4 139363724 missense probably benign 0.38
Predicted Primers PCR Primer
(F):5'- GACTTGAACTCTGAGCCACCTC -3'
(R):5'- TCAGCAAAAGTGTGGCTGC -3'

Sequencing Primer
(F):5'- GAACTCTGAGCCACCTCTAGCTG -3'
(R):5'- GCTGCTGATGCACTGGAAACTG -3'
Posted On 2022-09-12