Incidental Mutation 'R9611:Arhgef5'
ID 724212
Institutional Source Beutler Lab
Gene Symbol Arhgef5
Ensembl Gene ENSMUSG00000033542
Gene Name Rho guanine nucleotide exchange factor (GEF) 5
Synonyms 2210412D05Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9611 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 43265582-43289320 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 43280956 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Methionine at position 1311 (I1311M)
Ref Sequence ENSEMBL: ENSMUSP00000031750 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031750]
AlphaFold E9Q7D5
Predicted Effect probably damaging
Transcript: ENSMUST00000031750
AA Change: I1311M

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000031750
Gene: ENSMUSG00000033542
AA Change: I1311M

DomainStartEndE-ValueType
Pfam:ARHGEF5_35 1 477 3.1e-220 PFAM
low complexity region 509 531 N/A INTRINSIC
low complexity region 812 825 N/A INTRINSIC
low complexity region 827 851 N/A INTRINSIC
RhoGEF 1162 1341 2.97e-57 SMART
PH 1375 1488 1.11e-6 SMART
SH3 1497 1554 6.39e-15 SMART
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho GTPases play a fundamental role in numerous cellular processes initiated by extracellular stimuli that work through G protein coupled receptors. The encoded protein may form a complex with G proteins and stimulate Rho-dependent signals. This protein may be involved in the control of cytoskeletal organization. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased Th2 response in an ovalbumin-induced asthma model. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110051M20Rik T C 2: 91,304,782 D111G probably damaging Het
Adamts19 A T 18: 58,890,327 T265S probably benign Het
Ahnak T A 19: 9,011,798 L3482Q probably damaging Het
Apopt1 T G 12: 111,733,674 Y163D probably damaging Het
Bcr T A 10: 75,154,911 Y750N probably damaging Het
Bcr T A 10: 75,154,913 Y750* probably null Het
Btbd16 T A 7: 130,805,865 M295K probably benign Het
Ccdc88a T C 11: 29,477,316 L1007P possibly damaging Het
Cnep1r1 A G 8: 88,133,829 *126W probably null Het
Cntnap5b C A 1: 99,967,210 P69Q probably damaging Het
Col4a3 A G 1: 82,700,297 M1207V unknown Het
Colgalt2 T A 1: 152,484,994 W261R probably damaging Het
Cstf1 T A 2: 172,373,064 I35N probably benign Het
Cul9 A G 17: 46,519,897 L1690P possibly damaging Het
Dscaml1 C A 9: 45,668,224 N356K possibly damaging Het
Ecm2 A G 13: 49,515,042 N74D probably benign Het
Ecm2 A G 13: 49,527,740 I450M probably damaging Het
Emc1 T A 4: 139,363,724 D460E probably benign Het
Fam160b2 T C 14: 70,586,818 Y493C probably benign Het
Fmo5 C T 3: 97,641,773 R246C possibly damaging Het
Fyco1 T C 9: 123,828,520 T864A possibly damaging Het
Galk2 T C 2: 125,975,298 Y336H probably damaging Het
Gcsh T A 8: 116,993,386 Y14F probably benign Het
Grip1 G A 10: 120,038,664 E778K possibly damaging Het
Gucy2g T C 19: 55,206,173 I937M probably damaging Het
Hsp90ab1 T C 17: 45,569,674 I370M possibly damaging Het
Hypk T C 2: 121,457,673 S72P probably damaging Het
Ighv1-26 T C 12: 114,788,586 Y46C probably damaging Het
Kctd13 G T 7: 126,945,008 G293C probably damaging Het
Kmt2d CTGCTGTTGCTG CTGCTG 15: 98,845,173 probably benign Het
Kmt2d CTGTTG CTG 15: 98,845,176 probably benign Het
Krt13 T C 11: 100,121,492 S2G probably benign Het
Mark4 C A 7: 19,433,413 R467L possibly damaging Het
Mrps33 T A 6: 39,802,488 K91M probably damaging Het
Olfr209 A C 16: 59,361,879 I113S probably benign Het
Olfr566 T G 7: 102,856,940 H114P probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Peg10 C CTCA 6: 4,756,453 probably benign Het
Phldb3 G A 7: 24,628,947 V639M probably damaging Het
Pigyl A T 9: 22,158,203 H70L probably damaging Het
Pip4k2c A C 10: 127,200,200 L266R probably damaging Het
Plg T C 17: 12,390,326 Y173H probably benign Het
Pmp22 G T 11: 63,133,239 V25F probably benign Het
Pot1b T A 17: 55,699,995 T41S probably benign Het
Ppp1r16b T A 2: 158,696,078 Y40N probably damaging Het
Prl5a1 A G 13: 28,145,509 E57G possibly damaging Het
Prpf3 G A 3: 95,851,619 R74* probably null Het
Psmb10 A G 8: 105,937,512 F75S probably benign Het
Ptprm C A 17: 66,693,488 R1167M probably damaging Het
Rmnd5b T C 11: 51,627,042 I162V probably damaging Het
Sik1 T A 17: 31,854,272 K70M probably damaging Het
Slc44a4 C T 17: 34,928,817 S611F probably benign Het
St18 T C 1: 6,802,923 V294A probably benign Het
Stk32a A G 18: 43,297,555 I177V probably benign Het
Syne2 T C 12: 76,033,686 F58S probably benign Het
Tcf7l2 A G 19: 55,910,606 D215G probably null Het
Tcirg1 A T 19: 3,903,400 F149Y probably benign Het
Tex14 T A 11: 87,486,258 F143I probably damaging Het
Tjp3 A G 10: 81,283,577 V26A possibly damaging Het
Tnfaip8 ACACACTCTC AC 18: 50,046,841 probably benign Het
Tpx2 T A 2: 152,873,204 V115D probably benign Het
Tubb2b C A 13: 34,127,759 K350N probably damaging Het
Vps13b G T 15: 35,642,409 G1389V possibly damaging Het
Vps39 T C 2: 120,342,004 R183G probably damaging Het
Wdr47 A T 3: 108,611,413 E72D probably damaging Het
Wnk4 G T 11: 101,268,424 E556* probably null Het
Xpo7 T A 14: 70,688,177 E474V probably benign Het
Zfat A G 15: 68,179,806 V713A possibly damaging Het
Zfp189 G T 4: 49,530,058 C387F probably damaging Het
Zmiz1 T C 14: 25,650,598 V502A probably benign Het
Other mutations in Arhgef5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00341:Arhgef5 APN 6 43280269 nonsense probably null
IGL01341:Arhgef5 APN 6 43283991 missense probably damaging 1.00
IGL01576:Arhgef5 APN 6 43274028 missense probably benign 0.38
IGL01761:Arhgef5 APN 6 43274604 missense probably benign 0.00
IGL02104:Arhgef5 APN 6 43272411 missense probably damaging 0.99
IGL02208:Arhgef5 APN 6 43275130 missense probably benign 0.11
IGL02487:Arhgef5 APN 6 43283982 missense probably damaging 1.00
IGL02650:Arhgef5 APN 6 43272935 nonsense probably null
IGL03292:Arhgef5 APN 6 43280246 missense probably damaging 1.00
IGL03334:Arhgef5 APN 6 43274000 missense possibly damaging 0.47
IGL03341:Arhgef5 APN 6 43280651 missense probably damaging 0.99
R0047:Arhgef5 UTSW 6 43265621 splice site probably null
R0206:Arhgef5 UTSW 6 43273341 missense probably damaging 1.00
R0208:Arhgef5 UTSW 6 43273341 missense probably damaging 1.00
R0698:Arhgef5 UTSW 6 43273341 missense probably damaging 1.00
R1145:Arhgef5 UTSW 6 43273088 missense possibly damaging 0.92
R1145:Arhgef5 UTSW 6 43273088 missense possibly damaging 0.92
R1168:Arhgef5 UTSW 6 43273396 missense probably benign 0.00
R1355:Arhgef5 UTSW 6 43283912 missense probably damaging 1.00
R1370:Arhgef5 UTSW 6 43283912 missense probably damaging 1.00
R1481:Arhgef5 UTSW 6 43274634 missense probably damaging 0.99
R1529:Arhgef5 UTSW 6 43279515 missense probably damaging 0.96
R1532:Arhgef5 UTSW 6 43273403 missense probably benign
R1663:Arhgef5 UTSW 6 43276965 missense probably damaging 1.00
R1742:Arhgef5 UTSW 6 43280199 missense probably damaging 1.00
R1852:Arhgef5 UTSW 6 43275185 missense probably benign 0.00
R1869:Arhgef5 UTSW 6 43288682 missense probably damaging 1.00
R1880:Arhgef5 UTSW 6 43273088 missense possibly damaging 0.92
R2146:Arhgef5 UTSW 6 43283318 missense probably damaging 1.00
R2169:Arhgef5 UTSW 6 43274420 missense probably benign 0.11
R3412:Arhgef5 UTSW 6 43273790 missense probably benign
R4205:Arhgef5 UTSW 6 43273832 missense possibly damaging 0.76
R4226:Arhgef5 UTSW 6 43279498 missense probably damaging 1.00
R4227:Arhgef5 UTSW 6 43279498 missense probably damaging 1.00
R4304:Arhgef5 UTSW 6 43279498 missense probably damaging 1.00
R4308:Arhgef5 UTSW 6 43279498 missense probably damaging 1.00
R4457:Arhgef5 UTSW 6 43274093 missense probably damaging 1.00
R4469:Arhgef5 UTSW 6 43275099 missense probably benign
R4636:Arhgef5 UTSW 6 43274942 missense probably benign 0.11
R4791:Arhgef5 UTSW 6 43283183 missense probably damaging 1.00
R4818:Arhgef5 UTSW 6 43273550 missense probably benign 0.00
R4910:Arhgef5 UTSW 6 43272828 missense probably benign 0.01
R4911:Arhgef5 UTSW 6 43272828 missense probably benign 0.01
R5127:Arhgef5 UTSW 6 43273214 missense probably damaging 0.99
R5209:Arhgef5 UTSW 6 43273700 missense probably benign 0.01
R5245:Arhgef5 UTSW 6 43265680 start gained probably benign
R5251:Arhgef5 UTSW 6 43272881 missense possibly damaging 0.76
R5513:Arhgef5 UTSW 6 43272339 missense probably damaging 0.96
R5613:Arhgef5 UTSW 6 43274063 missense probably benign 0.01
R5616:Arhgef5 UTSW 6 43275940 missense probably benign 0.20
R5817:Arhgef5 UTSW 6 43275104 missense probably benign 0.15
R6024:Arhgef5 UTSW 6 43275134 missense probably benign 0.00
R6735:Arhgef5 UTSW 6 43275032 missense probably benign 0.01
R6825:Arhgef5 UTSW 6 43274961 missense probably damaging 0.99
R6831:Arhgef5 UTSW 6 43280999 missense probably damaging 1.00
R6901:Arhgef5 UTSW 6 43273298 missense probably benign 0.00
R6932:Arhgef5 UTSW 6 43274417 missense possibly damaging 0.94
R6968:Arhgef5 UTSW 6 43275342 missense probably benign 0.00
R7018:Arhgef5 UTSW 6 43288731 missense probably damaging 1.00
R7180:Arhgef5 UTSW 6 43275208 missense possibly damaging 0.87
R7201:Arhgef5 UTSW 6 43273232 nonsense probably null
R7358:Arhgef5 UTSW 6 43279573 missense probably damaging 1.00
R7359:Arhgef5 UTSW 6 43280282 missense probably damaging 1.00
R7468:Arhgef5 UTSW 6 43280671 nonsense probably null
R7503:Arhgef5 UTSW 6 43273999 missense probably benign 0.15
R7699:Arhgef5 UTSW 6 43274757 missense probably benign 0.11
R7700:Arhgef5 UTSW 6 43274757 missense probably benign 0.11
R7737:Arhgef5 UTSW 6 43273794 missense possibly damaging 0.84
R7847:Arhgef5 UTSW 6 43275135 nonsense probably null
R7950:Arhgef5 UTSW 6 43273925 missense possibly damaging 0.76
R8161:Arhgef5 UTSW 6 43283951 missense probably damaging 1.00
R8178:Arhgef5 UTSW 6 43275185 missense probably benign 0.00
R8203:Arhgef5 UTSW 6 43280645 missense probably damaging 1.00
R8318:Arhgef5 UTSW 6 43275999 critical splice donor site probably null
R8857:Arhgef5 UTSW 6 43287624 missense probably damaging 1.00
R9499:Arhgef5 UTSW 6 43284006 missense
R9610:Arhgef5 UTSW 6 43280956 missense probably damaging 0.99
R9623:Arhgef5 UTSW 6 43274802 missense possibly damaging 0.86
R9685:Arhgef5 UTSW 6 43273593 missense probably benign 0.11
RF023:Arhgef5 UTSW 6 43279473 missense probably damaging 1.00
X0028:Arhgef5 UTSW 6 43273701 missense probably benign 0.03
X0065:Arhgef5 UTSW 6 43272408 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CCTTGACTCAGACATGGTCTTG -3'
(R):5'- ACTGAGCTCTCCCCTTAGTG -3'

Sequencing Primer
(F):5'- CTCAGACATGGTCTTGGAGAG -3'
(R):5'- GAGCTCTCCCCTTAGTGTGGTC -3'
Posted On 2022-09-12