Incidental Mutation 'R9611:Krt13'
ID 724233
Institutional Source Beutler Lab
Gene Symbol Krt13
Ensembl Gene ENSMUSG00000044041
Gene Name keratin 13
Synonyms Krt1-13, K13, Krt-1.13
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.121) question?
Stock # R9611 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 100008153-100012392 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 100012318 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Glycine at position 2 (S2G)
Ref Sequence ENSEMBL: ENSMUSP00000007275 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007275]
AlphaFold P08730
Predicted Effect probably benign
Transcript: ENSMUST00000007275
AA Change: S2G

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000007275
Gene: ENSMUSG00000044041
AA Change: S2G

DomainStartEndE-ValueType
internal_repeat_1 5 21 1.02e-5 PROSPERO
internal_repeat_1 16 32 1.02e-5 PROSPERO
low complexity region 39 94 N/A INTRINSIC
Filament 95 407 7.21e-169 SMART
low complexity region 409 430 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the keratin gene family. The keratins are intermediate filament proteins responsible for the structural integrity of epithelial cells and are subdivided into cytokeratins and hair keratins. Most of the type I cytokeratins consist of acidic proteins which are arranged in pairs of heterotypic keratin chains. This type I cytokeratin is paired with keratin 4 and expressed in the suprabasal layers of non-cornified stratified epithelia. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2015]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts19 A T 18: 59,023,399 (GRCm39) T265S probably benign Het
Ahnak T A 19: 8,989,162 (GRCm39) L3482Q probably damaging Het
Arhgef5 A G 6: 43,257,890 (GRCm39) I1311M probably damaging Het
Bcr T A 10: 74,990,743 (GRCm39) Y750N probably damaging Het
Bcr T A 10: 74,990,745 (GRCm39) Y750* probably null Het
Btbd16 T A 7: 130,407,595 (GRCm39) M295K probably benign Het
Ccdc88a T C 11: 29,427,316 (GRCm39) L1007P possibly damaging Het
Cnep1r1 A G 8: 88,860,457 (GRCm39) *126W probably null Het
Cntnap5b C A 1: 99,894,935 (GRCm39) P69Q probably damaging Het
Coa8 T G 12: 111,700,108 (GRCm39) Y163D probably damaging Het
Col4a3 A G 1: 82,678,018 (GRCm39) M1207V unknown Het
Colgalt2 T A 1: 152,360,745 (GRCm39) W261R probably damaging Het
Cstf1 T A 2: 172,214,984 (GRCm39) I35N probably benign Het
Cstpp1 T C 2: 91,135,127 (GRCm39) D111G probably damaging Het
Cul9 A G 17: 46,830,823 (GRCm39) L1690P possibly damaging Het
Dscaml1 C A 9: 45,579,522 (GRCm39) N356K possibly damaging Het
Ecm2 A G 13: 49,668,518 (GRCm39) N74D probably benign Het
Ecm2 A G 13: 49,681,216 (GRCm39) I450M probably damaging Het
Emc1 T A 4: 139,091,035 (GRCm39) D460E probably benign Het
Fhip2b T C 14: 70,824,258 (GRCm39) Y493C probably benign Het
Fmo5 C T 3: 97,549,089 (GRCm39) R246C possibly damaging Het
Fyco1 T C 9: 123,657,585 (GRCm39) T864A possibly damaging Het
Galk2 T C 2: 125,817,218 (GRCm39) Y336H probably damaging Het
Gcsh T A 8: 117,720,125 (GRCm39) Y14F probably benign Het
Grip1 G A 10: 119,874,569 (GRCm39) E778K possibly damaging Het
Gucy2g T C 19: 55,194,605 (GRCm39) I937M probably damaging Het
Hsp90ab1 T C 17: 45,880,600 (GRCm39) I370M possibly damaging Het
Hypk T C 2: 121,288,154 (GRCm39) S72P probably damaging Het
Ighv1-26 T C 12: 114,752,206 (GRCm39) Y46C probably damaging Het
Kctd13 G T 7: 126,544,180 (GRCm39) G293C probably damaging Het
Kmt2d CTGCTGTTGCTG CTGCTG 15: 98,743,054 (GRCm39) probably benign Het
Kmt2d CTGTTG CTG 15: 98,743,057 (GRCm39) probably benign Het
Mark4 C A 7: 19,167,338 (GRCm39) R467L possibly damaging Het
Mrps33 T A 6: 39,779,422 (GRCm39) K91M probably damaging Het
Or51f1 T G 7: 102,506,147 (GRCm39) H114P probably damaging Het
Or5ac25 A C 16: 59,182,242 (GRCm39) I113S probably benign Het
Peg10 GC GCTCC 6: 4,756,452 (GRCm39) probably benign Het
Peg10 C CTCA 6: 4,756,453 (GRCm39) probably benign Het
Phldb3 G A 7: 24,328,372 (GRCm39) V639M probably damaging Het
Pigyl A T 9: 22,069,499 (GRCm39) H70L probably damaging Het
Pip4k2c A C 10: 127,036,069 (GRCm39) L266R probably damaging Het
Plg T C 17: 12,609,213 (GRCm39) Y173H probably benign Het
Pmp22 G T 11: 63,024,065 (GRCm39) V25F probably benign Het
Pot1b T A 17: 56,006,995 (GRCm39) T41S probably benign Het
Ppp1r16b T A 2: 158,537,998 (GRCm39) Y40N probably damaging Het
Prl5a1 A G 13: 28,329,492 (GRCm39) E57G possibly damaging Het
Prpf3 G A 3: 95,758,931 (GRCm39) R74* probably null Het
Psmb10 A G 8: 106,664,144 (GRCm39) F75S probably benign Het
Ptprm C A 17: 67,000,483 (GRCm39) R1167M probably damaging Het
Rmnd5b T C 11: 51,517,869 (GRCm39) I162V probably damaging Het
Sik1 T A 17: 32,073,246 (GRCm39) K70M probably damaging Het
Slc44a4 C T 17: 35,147,793 (GRCm39) S611F probably benign Het
St18 T C 1: 6,873,147 (GRCm39) V294A probably benign Het
Stk32a A G 18: 43,430,620 (GRCm39) I177V probably benign Het
Syne2 T C 12: 76,080,460 (GRCm39) F58S probably benign Het
Tcf7l2 A G 19: 55,899,038 (GRCm39) D215G probably null Het
Tcirg1 A T 19: 3,953,400 (GRCm39) F149Y probably benign Het
Tex14 T A 11: 87,377,084 (GRCm39) F143I probably damaging Het
Tjp3 A G 10: 81,119,411 (GRCm39) V26A possibly damaging Het
Tnfaip8 ACACACTCTC AC 18: 50,179,908 (GRCm39) probably benign Het
Tpx2 T A 2: 152,715,124 (GRCm39) V115D probably benign Het
Tubb2b C A 13: 34,311,742 (GRCm39) K350N probably damaging Het
Vps13b G T 15: 35,642,555 (GRCm39) G1389V possibly damaging Het
Vps39 T C 2: 120,172,485 (GRCm39) R183G probably damaging Het
Wdr47 A T 3: 108,518,729 (GRCm39) E72D probably damaging Het
Wnk4 G T 11: 101,159,250 (GRCm39) E556* probably null Het
Xpo7 T A 14: 70,925,617 (GRCm39) E474V probably benign Het
Zfat A G 15: 68,051,655 (GRCm39) V713A possibly damaging Het
Zfp189 G T 4: 49,530,058 (GRCm39) C387F probably damaging Het
Zmiz1 T C 14: 25,651,022 (GRCm39) V502A probably benign Het
Other mutations in Krt13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01780:Krt13 APN 11 100,010,539 (GRCm39) missense probably damaging 1.00
IGL02532:Krt13 APN 11 100,010,195 (GRCm39) missense probably damaging 1.00
IGL02934:Krt13 APN 11 100,009,910 (GRCm39) missense probably damaging 0.99
PIT4651001:Krt13 UTSW 11 100,010,862 (GRCm39) missense probably damaging 0.98
R0092:Krt13 UTSW 11 100,012,258 (GRCm39) nonsense probably null
R0722:Krt13 UTSW 11 100,009,979 (GRCm39) missense probably damaging 1.00
R1228:Krt13 UTSW 11 100,012,303 (GRCm39) missense probably benign 0.18
R1400:Krt13 UTSW 11 100,012,110 (GRCm39) missense probably damaging 1.00
R1751:Krt13 UTSW 11 100,011,926 (GRCm39) missense possibly damaging 0.84
R1767:Krt13 UTSW 11 100,011,926 (GRCm39) missense possibly damaging 0.84
R2420:Krt13 UTSW 11 100,010,877 (GRCm39) missense probably benign 0.43
R2421:Krt13 UTSW 11 100,010,877 (GRCm39) missense probably benign 0.43
R2869:Krt13 UTSW 11 100,008,475 (GRCm39) missense unknown
R2869:Krt13 UTSW 11 100,008,475 (GRCm39) missense unknown
R4421:Krt13 UTSW 11 100,009,761 (GRCm39) missense possibly damaging 0.94
R4451:Krt13 UTSW 11 100,008,827 (GRCm39) missense unknown
R4520:Krt13 UTSW 11 100,010,174 (GRCm39) missense probably damaging 0.99
R4632:Krt13 UTSW 11 100,012,050 (GRCm39) missense possibly damaging 0.96
R4656:Krt13 UTSW 11 100,010,189 (GRCm39) missense probably damaging 1.00
R4872:Krt13 UTSW 11 100,012,332 (GRCm39) start gained probably benign
R5709:Krt13 UTSW 11 100,008,469 (GRCm39) missense unknown
R6014:Krt13 UTSW 11 100,008,437 (GRCm39) missense unknown
R6323:Krt13 UTSW 11 100,011,976 (GRCm39) missense probably damaging 1.00
R6391:Krt13 UTSW 11 100,010,202 (GRCm39) missense probably damaging 0.96
R7535:Krt13 UTSW 11 100,008,824 (GRCm39) missense unknown
R7562:Krt13 UTSW 11 100,010,162 (GRCm39) missense probably damaging 1.00
R7867:Krt13 UTSW 11 100,012,008 (GRCm39) missense probably damaging 1.00
R7992:Krt13 UTSW 11 100,008,478 (GRCm39) missense unknown
R8379:Krt13 UTSW 11 100,009,706 (GRCm39) missense probably damaging 0.99
R8429:Krt13 UTSW 11 100,011,951 (GRCm39) missense probably damaging 1.00
R8560:Krt13 UTSW 11 100,009,676 (GRCm39) missense possibly damaging 0.85
R8728:Krt13 UTSW 11 100,012,318 (GRCm39) missense probably null 0.73
R8879:Krt13 UTSW 11 100,010,211 (GRCm39) missense probably benign 0.00
R8973:Krt13 UTSW 11 100,010,264 (GRCm39) missense possibly damaging 0.83
R9610:Krt13 UTSW 11 100,012,318 (GRCm39) missense probably benign 0.18
R9746:Krt13 UTSW 11 100,011,987 (GRCm39) missense possibly damaging 0.90
X0013:Krt13 UTSW 11 100,010,174 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTCTCGTTGCCAGAGAGGAG -3'
(R):5'- TAACTGGGCTTGTGGGAAAG -3'

Sequencing Primer
(F):5'- CAGAGAGGAGGCCACCATC -3'
(R):5'- GGAGGAACAGCTGGCATC -3'
Posted On 2022-09-12