Incidental Mutation 'R9612:Nup210l'
ID 724281
Institutional Source Beutler Lab
Gene Symbol Nup210l
Ensembl Gene ENSMUSG00000027939
Gene Name nucleoporin 210-like
Synonyms 4930548O11Rik, R26-EGFP, Tg(Gt(ROSA)26Sor-EGFP)130910Eps
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.350) question?
Stock # R9612 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 90104132-90212048 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 90199866 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Proline to Leucine at position 1570 (P1570L)
Ref Sequence ENSEMBL: ENSMUSP00000029548 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029548] [ENSMUST00000200410]
AlphaFold Q9D2F7
Predicted Effect probably benign
Transcript: ENSMUST00000029548
AA Change: P1570L

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000029548
Gene: ENSMUSG00000027939
AA Change: P1570L

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
BID_2 457 536 2.05e1 SMART
Blast:S1 949 1023 2e-16 BLAST
BID_2 1077 1152 4.51e-11 SMART
Blast:BID_2 1468 1550 7e-15 BLAST
transmembrane domain 1807 1829 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200410
AA Change: P1570L

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000143368
Gene: ENSMUSG00000027939
AA Change: P1570L

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
BID_2 457 536 6.9e-2 SMART
Blast:S1 938 1023 9e-17 BLAST
BID_2 1077 1152 1.5e-13 SMART
Blast:BID_2 1468 1550 7e-15 BLAST
transmembrane domain 1807 1829 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a transgene insertion exhibit male infertility, asthenozoospermia, teratozoospermia, azoospermia, and seminiferous tubule degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110004E09Rik A T 16: 90,927,387 M166K probably benign Het
2610021A01Rik T C 7: 41,626,903 S677P possibly damaging Het
4931406P16Rik A T 7: 34,248,231 C451S probably damaging Het
4932415D10Rik T A 10: 82,289,619 N2519I possibly damaging Het
5730480H06Rik A G 5: 48,374,530 I67V probably benign Het
Adam15 T A 3: 89,341,940 Y736F probably damaging Het
Adam29 A T 8: 55,872,083 F445L possibly damaging Het
Adgrv1 A G 13: 81,492,963 Y3318H probably damaging Het
Akap6 A G 12: 52,911,907 Y815C probably damaging Het
Ankar T A 1: 72,665,135 D876V possibly damaging Het
Atp6v1g2 G A 17: 35,237,757 V106I probably benign Het
Bdp1 A G 13: 100,077,862 S490P probably benign Het
Bet1 A T 6: 4,077,918 V107D probably damaging Het
Bri3bp T C 5: 125,454,326 V112A probably damaging Het
Cage1 T A 13: 38,032,375 D33V probably damaging Het
Ccdc146 G T 5: 21,330,579 A159E probably damaging Het
Ccnl1 C A 3: 65,957,983 G49V probably damaging Het
Cdk13 A C 13: 17,751,855 F787V Het
Cdk5r1 T C 11: 80,477,654 V49A probably benign Het
Cdon G A 9: 35,486,905 V973I probably damaging Het
Chd1l T A 3: 97,581,147 K518* probably null Het
Col24a1 A G 3: 145,545,205 D1653G probably benign Het
Cstf3 G T 2: 104,653,025 V359F possibly damaging Het
Dchs2 T C 3: 83,270,886 I1082T probably damaging Het
Dlec1 A T 9: 119,127,465 I736F probably damaging Het
Dnah9 T C 11: 65,927,649 N3288D probably benign Het
Ehbp1 T C 11: 22,169,124 D182G probably damaging Het
Evc2 G T 5: 37,386,786 E626D probably benign Het
Evi5 T C 5: 107,795,712 E589G probably benign Het
Exoc4 T C 6: 33,249,226 I25T probably benign Het
Extl2 T A 3: 116,027,496 *331R probably null Het
Fkbp8 G A 8: 70,531,674 R225H probably damaging Het
Foxred2 A T 15: 77,952,006 S384T probably damaging Het
Glmn T C 5: 107,593,865 E18G probably damaging Het
Gm17018 G T 19: 45,571,983 E82* probably null Het
Gm21936 A G 12: 87,795,737 I76V probably benign Het
Gm7489 C A 15: 53,885,972 Q147K unknown Het
Gm7489 A C 15: 53,885,973 Q147P unknown Het
Gm8005 T A 14: 42,438,398 I94F Het
Golgb1 G A 16: 36,919,605 V2810M probably benign Het
Gpr21 T C 2: 37,518,387 L315P probably damaging Het
Grip1 G A 10: 120,038,664 E778K possibly damaging Het
Herc6 T G 6: 57,652,032 S643A probably benign Het
Igkv14-100 T A 6: 68,519,333 I70N probably damaging Het
Kcnn3 A G 3: 89,609,396 M371V probably benign Het
Kif1a T A 1: 93,025,694 H1256L probably damaging Het
Klhdc4 A G 8: 121,801,178 S266P possibly damaging Het
Kmt2d CTGTTG CTG 15: 98,845,176 probably benign Het
Lefty2 T A 1: 180,894,721 L208Q probably damaging Het
Lingo2 T C 4: 35,708,450 Y510C probably damaging Het
Lrif1 T A 3: 106,731,884 V70D probably damaging Het
Lrrc74a A T 12: 86,758,571 K389I possibly damaging Het
Megf8 A T 7: 25,355,063 E1868V probably benign Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Mmp8 A G 9: 7,560,607 D95G probably damaging Het
Mmrn1 T A 6: 60,976,424 I563N probably damaging Het
Mroh3 T C 1: 136,190,975 T535A probably benign Het
Mroh9 A G 1: 163,038,929 L715P probably damaging Het
Myh6 G T 14: 54,963,597 A136E probably benign Het
Myom1 G T 17: 71,105,480 E1231* probably null Het
Nod2 G T 8: 88,670,473 C837F probably benign Het
Nos2 T A 11: 78,949,158 W698R probably damaging Het
Oas1a A T 5: 120,901,965 S188T possibly damaging Het
Ogfr GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG 2: 180,595,266 probably benign Het
Olfr1440 A T 19: 12,394,619 M119L probably damaging Het
Olfr396-ps1 T A 11: 73,928,549 D108E possibly damaging Het
Olfr490 A G 7: 108,286,280 M282T probably benign Het
Olfr836 T A 9: 19,121,464 S167T probably benign Het
Olfr847 A G 9: 19,375,381 S167P possibly damaging Het
Opa1 T C 16: 29,611,437 M394T Het
Oxct2a T A 4: 123,323,336 D84V probably damaging Het
Oxct2b A C 4: 123,117,226 D313A probably damaging Het
Phldb3 G A 7: 24,628,947 V639M probably damaging Het
Plppr4 T A 3: 117,321,961 N749I probably benign Het
Pmp22 G T 11: 63,133,239 V25F probably benign Het
Pofut2 A T 10: 77,265,929 M267L probably benign Het
Ppp1r42 T A 1: 9,968,842 N351I possibly damaging Het
Prl2b1 T C 13: 27,388,496 E37G probably benign Het
Ptpro G T 6: 137,414,320 V813F probably benign Het
Rnaseh2c T C 19: 5,602,315 F99L probably benign Het
Scn9a T A 2: 66,533,364 I857F probably damaging Het
Slf1 A G 13: 77,049,085 probably null Het
Smyd2 T C 1: 189,880,786 *434W probably null Het
Stk40 A G 4: 126,136,857 D290G probably damaging Het
Tdo2 C A 3: 81,971,694 W82C probably damaging Het
Tmem101 A G 11: 102,153,368 V231A probably damaging Het
Tns2 G A 15: 102,107,142 E160K probably damaging Het
Trim31 A T 17: 36,901,659 D174V probably benign Het
Unc13d A T 11: 116,070,318 Y404* probably null Het
Ush2a C A 1: 188,359,866 Y531* probably null Het
Vapa G A 17: 65,582,741 P144S probably benign Het
Vmn1r212 C T 13: 22,883,273 V297M possibly damaging Het
Vmn2r80 A C 10: 79,194,878 N846T probably damaging Het
Zfp811 A G 17: 32,798,766 V100A probably benign Het
Zfp958 T A 8: 4,628,298 C108S probably damaging Het
Zic5 G A 14: 122,459,688 T505I unknown Het
Other mutations in Nup210l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00780:Nup210l APN 3 90190849 splice site probably benign
IGL00813:Nup210l APN 3 90132418 missense probably benign 0.00
IGL01375:Nup210l APN 3 90159893 missense probably damaging 0.96
IGL01731:Nup210l APN 3 90154566 missense probably damaging 1.00
IGL01786:Nup210l APN 3 90122776 nonsense probably null
IGL01958:Nup210l APN 3 90203924 missense possibly damaging 0.74
IGL02094:Nup210l APN 3 90180213 critical splice donor site probably null
IGL02120:Nup210l APN 3 90136862 missense probably damaging 1.00
IGL02313:Nup210l APN 3 90122792 missense probably damaging 1.00
IGL02336:Nup210l APN 3 90181552 critical splice donor site probably null
IGL02348:Nup210l APN 3 90104164 utr 5 prime probably benign
IGL02372:Nup210l APN 3 90201971 missense possibly damaging 0.80
IGL02557:Nup210l APN 3 90124230 missense probably damaging 1.00
IGL02559:Nup210l APN 3 90159953 missense probably benign 0.02
IGL02738:Nup210l APN 3 90136850 missense possibly damaging 0.80
IGL03231:Nup210l APN 3 90189545 missense probably damaging 1.00
IGL03257:Nup210l APN 3 90180148 critical splice acceptor site probably null
IGL03388:Nup210l APN 3 90170044 missense probably damaging 1.00
IGL03134:Nup210l UTSW 3 90190887 missense possibly damaging 0.85
R0003:Nup210l UTSW 3 90119911 missense probably damaging 1.00
R0040:Nup210l UTSW 3 90181905 missense probably damaging 1.00
R0083:Nup210l UTSW 3 90189575 missense probably damaging 1.00
R0090:Nup210l UTSW 3 90211779 missense probably benign 0.00
R0108:Nup210l UTSW 3 90189575 missense probably damaging 1.00
R0142:Nup210l UTSW 3 90172113 missense probably damaging 1.00
R0306:Nup210l UTSW 3 90207368 missense probably benign 0.13
R0332:Nup210l UTSW 3 90132309 splice site probably benign
R0346:Nup210l UTSW 3 90189438 missense probably damaging 1.00
R0463:Nup210l UTSW 3 90180211 missense probably null 1.00
R0622:Nup210l UTSW 3 90167740 missense probably damaging 0.98
R0765:Nup210l UTSW 3 90119877 missense probably damaging 0.99
R0990:Nup210l UTSW 3 90211925 missense probably benign 0.00
R1014:Nup210l UTSW 3 90170048 missense possibly damaging 0.62
R1036:Nup210l UTSW 3 90192940 splice site probably benign
R1177:Nup210l UTSW 3 90202003 missense probably benign 0.11
R1183:Nup210l UTSW 3 90159945 missense probably benign 0.04
R1188:Nup210l UTSW 3 90198179 missense probably benign 0.16
R1457:Nup210l UTSW 3 90190972 missense possibly damaging 0.68
R1471:Nup210l UTSW 3 90170562 missense probably benign
R1627:Nup210l UTSW 3 90144169 missense probably benign 0.15
R1778:Nup210l UTSW 3 90189486 missense probably damaging 0.99
R1827:Nup210l UTSW 3 90154557 missense probably damaging 1.00
R1843:Nup210l UTSW 3 90172086 missense probably damaging 0.96
R1858:Nup210l UTSW 3 90154499 missense probably damaging 0.97
R1942:Nup210l UTSW 3 90151237 missense probably benign 0.01
R2015:Nup210l UTSW 3 90185432 missense probably damaging 1.00
R2113:Nup210l UTSW 3 90190974 missense possibly damaging 0.48
R2944:Nup210l UTSW 3 90181545 missense probably damaging 1.00
R3736:Nup210l UTSW 3 90120013 missense probably damaging 1.00
R3740:Nup210l UTSW 3 90207394 missense probably benign 0.08
R3741:Nup210l UTSW 3 90207394 missense probably benign 0.08
R3742:Nup210l UTSW 3 90207394 missense probably benign 0.08
R3771:Nup210l UTSW 3 90119894 nonsense probably null
R3773:Nup210l UTSW 3 90119894 nonsense probably null
R3879:Nup210l UTSW 3 90185473 missense probably damaging 1.00
R3882:Nup210l UTSW 3 90124210 missense probably benign 0.19
R3953:Nup210l UTSW 3 90193054 missense possibly damaging 0.89
R3954:Nup210l UTSW 3 90193054 missense possibly damaging 0.89
R3955:Nup210l UTSW 3 90193054 missense possibly damaging 0.89
R3956:Nup210l UTSW 3 90193054 missense possibly damaging 0.89
R4200:Nup210l UTSW 3 90119911 missense probably damaging 1.00
R4290:Nup210l UTSW 3 90207326 missense probably benign 0.00
R4328:Nup210l UTSW 3 90175835 splice site probably null
R4629:Nup210l UTSW 3 90167875 missense probably benign 0.21
R4629:Nup210l UTSW 3 90190874 nonsense probably null
R4897:Nup210l UTSW 3 90193071 missense probably damaging 1.00
R4906:Nup210l UTSW 3 90170030 missense probably benign 0.06
R4966:Nup210l UTSW 3 90106901 missense probably benign 0.00
R5004:Nup210l UTSW 3 90180165 nonsense probably null
R5237:Nup210l UTSW 3 90180198 missense probably benign 0.00
R5499:Nup210l UTSW 3 90174370 missense probably damaging 1.00
R5522:Nup210l UTSW 3 90154665 missense probably benign 0.10
R5627:Nup210l UTSW 3 90144250 missense probably damaging 0.97
R5678:Nup210l UTSW 3 90190959 missense probably damaging 0.99
R5726:Nup210l UTSW 3 90129207 splice site probably null
R5792:Nup210l UTSW 3 90199857 missense probably damaging 1.00
R6129:Nup210l UTSW 3 90104176 missense probably benign 0.00
R6272:Nup210l UTSW 3 90170024 missense possibly damaging 0.57
R6290:Nup210l UTSW 3 90119909 nonsense probably null
R6293:Nup210l UTSW 3 90115064 missense probably damaging 1.00
R6446:Nup210l UTSW 3 90172068 missense probably damaging 1.00
R6698:Nup210l UTSW 3 90182508 missense possibly damaging 0.57
R6855:Nup210l UTSW 3 90136924 missense probably benign 0.01
R6895:Nup210l UTSW 3 90159924 missense probably damaging 0.97
R6899:Nup210l UTSW 3 90167897 missense possibly damaging 0.77
R6978:Nup210l UTSW 3 90154566 missense possibly damaging 0.86
R6980:Nup210l UTSW 3 90119927 missense probably benign 0.04
R7038:Nup210l UTSW 3 90159947 missense probably damaging 1.00
R7273:Nup210l UTSW 3 90118547 missense probably benign 0.04
R7450:Nup210l UTSW 3 90115188 critical splice donor site probably null
R7514:Nup210l UTSW 3 90210459 critical splice donor site probably null
R7658:Nup210l UTSW 3 90211993 missense probably benign 0.43
R7735:Nup210l UTSW 3 90185576 missense probably damaging 1.00
R7772:Nup210l UTSW 3 90159926 missense probably damaging 1.00
R7800:Nup210l UTSW 3 90134597 missense probably damaging 1.00
R7840:Nup210l UTSW 3 90122729 missense probably benign 0.08
R7847:Nup210l UTSW 3 90151123 missense probably benign
R7848:Nup210l UTSW 3 90203905 missense probably benign 0.01
R8084:Nup210l UTSW 3 90136058 missense probably benign 0.15
R8121:Nup210l UTSW 3 90115121 missense probably damaging 1.00
R8421:Nup210l UTSW 3 90203867 missense probably damaging 1.00
R8458:Nup210l UTSW 3 90185567 missense probably null 1.00
R8701:Nup210l UTSW 3 90122814 missense probably benign 0.41
R8720:Nup210l UTSW 3 90210374 missense probably benign 0.00
R8770:Nup210l UTSW 3 90118543 missense probably damaging 1.00
R8896:Nup210l UTSW 3 90118625 missense probably damaging 1.00
R9033:Nup210l UTSW 3 90198089 missense probably benign
R9371:Nup210l UTSW 3 90199866 missense probably benign 0.01
R9373:Nup210l UTSW 3 90199866 missense probably benign 0.01
R9381:Nup210l UTSW 3 90199866 missense probably benign 0.01
R9426:Nup210l UTSW 3 90199866 missense probably benign 0.01
R9427:Nup210l UTSW 3 90199866 missense probably benign 0.01
R9501:Nup210l UTSW 3 90199866 missense probably benign 0.01
R9523:Nup210l UTSW 3 90199866 missense probably benign 0.01
R9574:Nup210l UTSW 3 90210386 missense probably benign
R9654:Nup210l UTSW 3 90199866 missense probably benign 0.01
R9660:Nup210l UTSW 3 90198095 missense probably benign 0.30
R9660:Nup210l UTSW 3 90199866 missense probably benign 0.01
R9662:Nup210l UTSW 3 90199866 missense probably benign 0.01
R9682:Nup210l UTSW 3 90144162 missense possibly damaging 0.79
R9729:Nup210l UTSW 3 90199866 missense probably benign 0.01
R9750:Nup210l UTSW 3 90210352 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- ATGCATGCACCCACATTCCC -3'
(R):5'- AGGTATTTACTACTAAGCATAGCCA -3'

Sequencing Primer
(F):5'- CTGAGGACAGCTACAGTGTACTTAC -3'
(R):5'- CTGTGGAGAAACTCCTTACC -3'
Posted On 2022-09-12