Incidental Mutation 'R9612:Ptpro'
ID 724303
Institutional Source Beutler Lab
Gene Symbol Ptpro
Ensembl Gene ENSMUSG00000030223
Gene Name protein tyrosine phosphatase, receptor type, O
Synonyms Ptpn15, PTP-oc, GLEPP1, PTP-U2, PTP-BK, PTP-phi, D28, PTPROt
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9612 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 137252319-137463233 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 137414320 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Phenylalanine at position 813 (V813F)
Ref Sequence ENSEMBL: ENSMUSP00000076364 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077115] [ENSMUST00000167002] [ENSMUST00000167679] [ENSMUST00000203914]
AlphaFold E9Q612
Predicted Effect probably benign
Transcript: ENSMUST00000077115
AA Change: V813F

PolyPhen 2 Score 0.306 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000076364
Gene: ENSMUSG00000030223
AA Change: V813F

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
low complexity region 269 291 N/A INTRINSIC
FN3 443 528 1.07e-1 SMART
FN3 540 626 7.07e-2 SMART
FN3 642 722 4.47e1 SMART
FN3 733 812 5.92e-4 SMART
transmembrane domain 831 853 N/A INTRINSIC
transmembrane domain 890 912 N/A INTRINSIC
PTPc 947 1207 1.43e-127 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167002
SMART Domains Protein: ENSMUSP00000131764
Gene: ENSMUSG00000030223

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
transmembrane domain 69 91 N/A INTRINSIC
PTPc 126 386 1.43e-127 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000167679
AA Change: V813F

PolyPhen 2 Score 0.458 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000127112
Gene: ENSMUSG00000030223
AA Change: V813F

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
low complexity region 269 291 N/A INTRINSIC
FN3 443 528 1.07e-1 SMART
FN3 540 626 7.07e-2 SMART
FN3 642 722 4.47e1 SMART
FN3 733 812 5.92e-4 SMART
transmembrane domain 831 853 N/A INTRINSIC
PTPc 919 1179 1.43e-127 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000203914
SMART Domains Protein: ENSMUSP00000144870
Gene: ENSMUSG00000030223

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
PTPc 98 358 6.1e-130 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the R3 subtype family of receptor-type protein tyrosine phosphatases. These proteins are localized to the apical surface of polarized cells and may have tissue-specific functions through activation of Src family kinases. This gene contains two distinct promoters, and alternatively spliced transcript variants encoding multiple isoforms have been observed. The encoded proteins may have multiple isoform-specific and tissue-specific functions, including the regulation of osteoclast production and activity, inhibition of cell proliferation and facilitation of apoptosis. This gene is a candidate tumor suppressor, and decreased expression of this gene has been observed in several types of cancer. [provided by RefSeq, May 2011]
PHENOTYPE: Mice homozygous for one allele display impaired glomerular filtration due to podocyte structural anomalies and a predisposition for hypertension. Mice homozygous for a second allele exhibit susceptibility to pharmacologically induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110004E09Rik A T 16: 90,927,387 M166K probably benign Het
2610021A01Rik T C 7: 41,626,903 S677P possibly damaging Het
4931406P16Rik A T 7: 34,248,231 C451S probably damaging Het
4932415D10Rik T A 10: 82,289,619 N2519I possibly damaging Het
5730480H06Rik A G 5: 48,374,530 I67V probably benign Het
Adam15 T A 3: 89,341,940 Y736F probably damaging Het
Adam29 A T 8: 55,872,083 F445L possibly damaging Het
Adgrv1 A G 13: 81,492,963 Y3318H probably damaging Het
Akap6 A G 12: 52,911,907 Y815C probably damaging Het
Ankar T A 1: 72,665,135 D876V possibly damaging Het
Atp6v1g2 G A 17: 35,237,757 V106I probably benign Het
Bdp1 A G 13: 100,077,862 S490P probably benign Het
Bet1 A T 6: 4,077,918 V107D probably damaging Het
Bri3bp T C 5: 125,454,326 V112A probably damaging Het
Cage1 T A 13: 38,032,375 D33V probably damaging Het
Ccdc146 G T 5: 21,330,579 A159E probably damaging Het
Ccnl1 C A 3: 65,957,983 G49V probably damaging Het
Cdk13 A C 13: 17,751,855 F787V Het
Cdk5r1 T C 11: 80,477,654 V49A probably benign Het
Cdon G A 9: 35,486,905 V973I probably damaging Het
Chd1l T A 3: 97,581,147 K518* probably null Het
Col24a1 A G 3: 145,545,205 D1653G probably benign Het
Cstf3 G T 2: 104,653,025 V359F possibly damaging Het
Dchs2 T C 3: 83,270,886 I1082T probably damaging Het
Dlec1 A T 9: 119,127,465 I736F probably damaging Het
Dnah9 T C 11: 65,927,649 N3288D probably benign Het
Ehbp1 T C 11: 22,169,124 D182G probably damaging Het
Evc2 G T 5: 37,386,786 E626D probably benign Het
Evi5 T C 5: 107,795,712 E589G probably benign Het
Exoc4 T C 6: 33,249,226 I25T probably benign Het
Extl2 T A 3: 116,027,496 *331R probably null Het
Fkbp8 G A 8: 70,531,674 R225H probably damaging Het
Foxred2 A T 15: 77,952,006 S384T probably damaging Het
Glmn T C 5: 107,593,865 E18G probably damaging Het
Gm17018 G T 19: 45,571,983 E82* probably null Het
Gm21936 A G 12: 87,795,737 I76V probably benign Het
Gm7489 C A 15: 53,885,972 Q147K unknown Het
Gm7489 A C 15: 53,885,973 Q147P unknown Het
Gm8005 T A 14: 42,438,398 I94F Het
Golgb1 G A 16: 36,919,605 V2810M probably benign Het
Gpr21 T C 2: 37,518,387 L315P probably damaging Het
Grip1 G A 10: 120,038,664 E778K possibly damaging Het
Herc6 T G 6: 57,652,032 S643A probably benign Het
Igkv14-100 T A 6: 68,519,333 I70N probably damaging Het
Kcnn3 A G 3: 89,609,396 M371V probably benign Het
Kif1a T A 1: 93,025,694 H1256L probably damaging Het
Klhdc4 A G 8: 121,801,178 S266P possibly damaging Het
Kmt2d CTGTTG CTG 15: 98,845,176 probably benign Het
Lefty2 T A 1: 180,894,721 L208Q probably damaging Het
Lingo2 T C 4: 35,708,450 Y510C probably damaging Het
Lrif1 T A 3: 106,731,884 V70D probably damaging Het
Lrrc74a A T 12: 86,758,571 K389I possibly damaging Het
Megf8 A T 7: 25,355,063 E1868V probably benign Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Mmp8 A G 9: 7,560,607 D95G probably damaging Het
Mmrn1 T A 6: 60,976,424 I563N probably damaging Het
Mroh3 T C 1: 136,190,975 T535A probably benign Het
Mroh9 A G 1: 163,038,929 L715P probably damaging Het
Myh6 G T 14: 54,963,597 A136E probably benign Het
Myom1 G T 17: 71,105,480 E1231* probably null Het
Nod2 G T 8: 88,670,473 C837F probably benign Het
Nos2 T A 11: 78,949,158 W698R probably damaging Het
Nup210l C T 3: 90,199,866 P1570L probably benign Het
Oas1a A T 5: 120,901,965 S188T possibly damaging Het
Ogfr GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG 2: 180,595,266 probably benign Het
Olfr1440 A T 19: 12,394,619 M119L probably damaging Het
Olfr396-ps1 T A 11: 73,928,549 D108E possibly damaging Het
Olfr490 A G 7: 108,286,280 M282T probably benign Het
Olfr836 T A 9: 19,121,464 S167T probably benign Het
Olfr847 A G 9: 19,375,381 S167P possibly damaging Het
Opa1 T C 16: 29,611,437 M394T Het
Oxct2a T A 4: 123,323,336 D84V probably damaging Het
Oxct2b A C 4: 123,117,226 D313A probably damaging Het
Phldb3 G A 7: 24,628,947 V639M probably damaging Het
Plppr4 T A 3: 117,321,961 N749I probably benign Het
Pmp22 G T 11: 63,133,239 V25F probably benign Het
Pofut2 A T 10: 77,265,929 M267L probably benign Het
Ppp1r42 T A 1: 9,968,842 N351I possibly damaging Het
Prl2b1 T C 13: 27,388,496 E37G probably benign Het
Rnaseh2c T C 19: 5,602,315 F99L probably benign Het
Scn9a T A 2: 66,533,364 I857F probably damaging Het
Slf1 A G 13: 77,049,085 probably null Het
Smyd2 T C 1: 189,880,786 *434W probably null Het
Stk40 A G 4: 126,136,857 D290G probably damaging Het
Tdo2 C A 3: 81,971,694 W82C probably damaging Het
Tmem101 A G 11: 102,153,368 V231A probably damaging Het
Tns2 G A 15: 102,107,142 E160K probably damaging Het
Trim31 A T 17: 36,901,659 D174V probably benign Het
Unc13d A T 11: 116,070,318 Y404* probably null Het
Ush2a C A 1: 188,359,866 Y531* probably null Het
Vapa G A 17: 65,582,741 P144S probably benign Het
Vmn1r212 C T 13: 22,883,273 V297M possibly damaging Het
Vmn2r80 A C 10: 79,194,878 N846T probably damaging Het
Zfp811 A G 17: 32,798,766 V100A probably benign Het
Zfp958 T A 8: 4,628,298 C108S probably damaging Het
Zic5 G A 14: 122,459,688 T505I unknown Het
Other mutations in Ptpro
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Ptpro APN 6 137394909 critical splice donor site probably null
IGL00844:Ptpro APN 6 137414239 missense probably damaging 1.00
IGL00983:Ptpro APN 6 137418248 missense probably benign 0.01
IGL01073:Ptpro APN 6 137377088 missense probably damaging 1.00
IGL01832:Ptpro APN 6 137393668 missense possibly damaging 0.93
IGL02308:Ptpro APN 6 137454700 missense probably benign 0.37
IGL02387:Ptpro APN 6 137410980 missense probably damaging 0.96
IGL02605:Ptpro APN 6 137380318 missense probably benign 0.02
IGL02666:Ptpro APN 6 137378059 missense probably damaging 0.96
IGL03275:Ptpro APN 6 137450006 missense probably damaging 1.00
Brau UTSW 6 137454598 missense probably damaging 1.00
court UTSW 6 137393675 nonsense probably null
Hoff UTSW 6 137443594 missense probably damaging 1.00
Jester UTSW 6 137449917 missense probably damaging 1.00
mann UTSW 6 137411116 splice site probably null
R0017:Ptpro UTSW 6 137416827 missense probably benign 0.03
R0017:Ptpro UTSW 6 137416827 missense probably benign 0.03
R0020:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0022:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0023:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0024:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0094:Ptpro UTSW 6 137386352 missense probably benign 0.08
R0094:Ptpro UTSW 6 137386352 missense probably benign 0.08
R0103:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0106:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0316:Ptpro UTSW 6 137376989 missense possibly damaging 0.81
R0427:Ptpro UTSW 6 137368296 missense possibly damaging 0.81
R0456:Ptpro UTSW 6 137414230 missense probably benign 0.04
R0536:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0537:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0552:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0555:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0664:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0708:Ptpro UTSW 6 137386253 missense probably benign 0.26
R0730:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0735:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0738:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0786:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0811:Ptpro UTSW 6 137368079 missense probably benign 0.00
R0812:Ptpro UTSW 6 137368079 missense probably benign 0.00
R0881:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0973:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1145:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1145:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1146:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1146:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1147:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1147:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1259:Ptpro UTSW 6 137392741 missense probably damaging 0.98
R1340:Ptpro UTSW 6 137441081 missense possibly damaging 0.95
R1381:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1382:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1385:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1396:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1401:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1416:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1422:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1448:Ptpro UTSW 6 137441116 missense probably damaging 1.00
R1513:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1518:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1526:Ptpro UTSW 6 137461726 missense probably damaging 1.00
R1540:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1571:Ptpro UTSW 6 137378130 missense probably benign
R1573:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1587:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1588:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1649:Ptpro UTSW 6 137444017 nonsense probably null
R1700:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1701:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1745:Ptpro UTSW 6 137400645 missense probably benign 0.03
R1772:Ptpro UTSW 6 137430743 missense probably damaging 1.00
R1911:Ptpro UTSW 6 137400619 splice site probably benign
R1958:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1967:Ptpro UTSW 6 137416865 missense probably benign 0.38
R2025:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R2026:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R2040:Ptpro UTSW 6 137386164 splice site probably benign
R2115:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R2117:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R2130:Ptpro UTSW 6 137411116 splice site probably null
R2161:Ptpro UTSW 6 137449887 missense probably benign 0.01
R2431:Ptpro UTSW 6 137443585 nonsense probably null
R2915:Ptpro UTSW 6 137414241 start gained probably benign
R2988:Ptpro UTSW 6 137443599 nonsense probably null
R3772:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R3773:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R3795:Ptpro UTSW 6 137380309 missense probably benign
R3885:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R3886:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R3887:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R3888:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R3893:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R4032:Ptpro UTSW 6 137461742 missense probably damaging 1.00
R4133:Ptpro UTSW 6 137420372 missense probably damaging 1.00
R4377:Ptpro UTSW 6 137380266 missense probably benign 0.26
R4455:Ptpro UTSW 6 137393659 missense probably damaging 1.00
R4613:Ptpro UTSW 6 137416836 nonsense probably null
R4827:Ptpro UTSW 6 137442710 missense probably damaging 1.00
R4863:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R4870:Ptpro UTSW 6 137377132 missense probably damaging 0.96
R4910:Ptpro UTSW 6 137368338 missense probably damaging 0.99
R4932:Ptpro UTSW 6 137411105 nonsense probably null
R4941:Ptpro UTSW 6 137392765 missense probably damaging 1.00
R4989:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R5009:Ptpro UTSW 6 137377132 missense probably damaging 0.96
R5032:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R5033:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R5162:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R5393:Ptpro UTSW 6 137380224 missense probably benign 0.04
R5423:Ptpro UTSW 6 137442707 missense probably damaging 1.00
R5782:Ptpro UTSW 6 137399498 missense possibly damaging 0.80
R6103:Ptpro UTSW 6 137400706 missense possibly damaging 0.76
R6239:Ptpro UTSW 6 137380608 missense probably benign 0.28
R6488:Ptpro UTSW 6 137393675 nonsense probably null
R6494:Ptpro UTSW 6 137382642 missense probably benign 0.20
R6746:Ptpro UTSW 6 137394823 missense probably damaging 1.00
R6763:Ptpro UTSW 6 137418281 splice site probably null
R6888:Ptpro UTSW 6 137380200 missense probably benign 0.30
R6983:Ptpro UTSW 6 137449917 missense probably damaging 1.00
R7019:Ptpro UTSW 6 137380478 missense probably benign
R7218:Ptpro UTSW 6 137454598 missense probably damaging 1.00
R7236:Ptpro UTSW 6 137368337 missense probably damaging 1.00
R7299:Ptpro UTSW 6 137441144 critical splice donor site probably null
R7381:Ptpro UTSW 6 137399561 missense possibly damaging 0.93
R7493:Ptpro UTSW 6 137382649 missense probably benign 0.01
R7733:Ptpro UTSW 6 137414286 nonsense probably null
R7793:Ptpro UTSW 6 137416820 missense probably damaging 0.99
R7804:Ptpro UTSW 6 137399601 splice site probably null
R7833:Ptpro UTSW 6 137416863 nonsense probably null
R7859:Ptpro UTSW 6 137392807 critical splice donor site probably null
R7873:Ptpro UTSW 6 137430739 missense probably benign 0.44
R8042:Ptpro UTSW 6 137416883 missense possibly damaging 0.71
R8859:Ptpro UTSW 6 137426784 nonsense probably null
R8979:Ptpro UTSW 6 137368142 missense probably benign
R9138:Ptpro UTSW 6 137411115 critical splice donor site probably null
R9309:Ptpro UTSW 6 137454658 missense probably damaging 1.00
R9420:Ptpro UTSW 6 137443935 missense probably benign 0.08
R9625:Ptpro UTSW 6 137394875 missense probably damaging 1.00
R9697:Ptpro UTSW 6 137386290 missense probably damaging 1.00
R9715:Ptpro UTSW 6 137368110 missense probably damaging 0.96
Z1177:Ptpro UTSW 6 137378140 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTAATGAGGGCTGCTTCCATG -3'
(R):5'- TCCCTGAACCTGTAGCTTGG -3'

Sequencing Primer
(F):5'- GGGGGAGTTTTTCACTATTAACC -3'
(R):5'- ACCAGATTGCCTCAGTC -3'
Posted On 2022-09-12