Incidental Mutation 'R0762:Spats2l'
ID72432
Institutional Source Beutler Lab
Gene Symbol Spats2l
Ensembl Gene ENSMUSG00000038305
Gene Namespermatogenesis associated, serine-rich 2-like
SynonymsA230104H11Rik, 2810022L02Rik
MMRRC Submission 038942-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.133) question?
Stock #R0762 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location57774162-57948394 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 57885884 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 127 (L127P)
Ref Sequence ENSEMBL: ENSMUSP00000132592 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000163239] [ENSMUST00000164302] [ENSMUST00000167085] [ENSMUST00000167971] [ENSMUST00000169772] [ENSMUST00000170139] [ENSMUST00000171699] [ENSMUST00000172068] [ENSMUST00000172287]
Predicted Effect probably benign
Transcript: ENSMUST00000163239
AA Change: L20P

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000128992
Gene: ENSMUSG00000038305
AA Change: L20P

DomainStartEndE-ValueType
Pfam:DUF1387 1 261 9.7e-124 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000164302
AA Change: L127P

PolyPhen 2 Score 0.883 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000132592
Gene: ENSMUSG00000038305
AA Change: L127P

DomainStartEndE-ValueType
Pfam:DUF1387 59 149 3.6e-25 PFAM
Pfam:DUF1387 146 299 1.6e-93 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167085
AA Change: L147P

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000133054
Gene: ENSMUSG00000038305
AA Change: L147P

DomainStartEndE-ValueType
Pfam:DUF1387 79 388 1.8e-130 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167971
SMART Domains Protein: ENSMUSP00000128764
Gene: ENSMUSG00000038305

DomainStartEndE-ValueType
Pfam:DUF1387 79 130 4.2e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169772
AA Change: L127P

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000132975
Gene: ENSMUSG00000038305
AA Change: L127P

DomainStartEndE-ValueType
Pfam:DUF1387 59 368 5.6e-139 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170139
AA Change: L127P

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000127598
Gene: ENSMUSG00000038305
AA Change: L127P

DomainStartEndE-ValueType
Pfam:DUF1387 59 368 5.6e-139 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171699
AA Change: L147P

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000128239
Gene: ENSMUSG00000038305
AA Change: L147P

DomainStartEndE-ValueType
Pfam:DUF1387 79 169 1.2e-25 PFAM
Pfam:DUF1387 167 270 2e-60 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172068
AA Change: L147P

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000126166
Gene: ENSMUSG00000038305
AA Change: L147P

DomainStartEndE-ValueType
Pfam:DUF1387 79 244 5e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172287
SMART Domains Protein: ENSMUSP00000131125
Gene: ENSMUSG00000038305

DomainStartEndE-ValueType
low complexity region 84 96 N/A INTRINSIC
Meta Mutation Damage Score 0.0789 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 93.9%
Validation Efficiency 100% (61/61)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik A G 15: 8,218,416 probably benign Het
4921504E06Rik T A 2: 19,477,856 N475I probably damaging Het
Adar T C 3: 89,739,983 probably benign Het
Aldh3b3 A T 19: 3,965,747 probably null Het
Amtn C T 5: 88,385,000 T158I possibly damaging Het
Ap1g2 A G 14: 55,100,411 probably benign Het
Arhgef3 A G 14: 27,397,627 Y318C probably damaging Het
Atg2b A C 12: 105,674,970 V69G possibly damaging Het
Bbx G A 16: 50,225,166 T236I possibly damaging Het
Bcl11b C T 12: 107,965,663 probably benign Het
Catsperg1 T C 7: 29,189,952 I794V probably benign Het
Ccdc88a C T 11: 29,463,112 probably benign Het
Cdhr3 C A 12: 33,060,301 R328L probably benign Het
Ces2e T A 8: 104,929,864 M242K probably damaging Het
Col12a1 A G 9: 79,681,374 probably benign Het
Col3a1 T C 1: 45,321,526 S39P unknown Het
Cyp2a5 T A 7: 26,838,873 Y220* probably null Het
D3Ertd254e G A 3: 36,165,867 D680N possibly damaging Het
Dcc T A 18: 71,342,705 probably benign Het
Dnajb8 A G 6: 88,223,054 T191A probably damaging Het
Ephx2 A T 14: 66,102,179 F199I probably damaging Het
Fancd2 A G 6: 113,574,658 K1062E probably benign Het
Fbxo33 A G 12: 59,204,499 V410A probably benign Het
Gars T G 6: 55,077,580 probably null Het
Git1 A C 11: 77,499,834 D132A possibly damaging Het
Gm853 A G 4: 130,221,624 S44P probably damaging Het
Gp1ba C T 11: 70,641,427 P673L probably damaging Het
Gucy1a1 T C 3: 82,094,896 T44A unknown Het
Hjurp G C 1: 88,277,215 probably benign Het
Ifnlr1 A G 4: 135,701,329 K156E possibly damaging Het
Klf13 T C 7: 63,891,623 N15S probably benign Het
Krt77 T C 15: 101,861,126 probably null Het
Map4 C A 9: 110,038,478 probably benign Het
Mthfr T C 4: 148,055,443 I623T possibly damaging Het
Myo7b T A 18: 31,983,944 T908S probably benign Het
Nbeal2 T G 9: 110,643,808 probably benign Het
Nwd2 T G 5: 63,800,414 F362L probably benign Het
Pcm1 A T 8: 41,261,020 R208W probably damaging Het
Pkd2l1 T C 19: 44,150,470 D647G probably benign Het
Plbd1 C T 6: 136,641,147 V24M probably damaging Het
Polr2a G A 11: 69,735,117 P1698S unknown Het
Prss12 T C 3: 123,485,504 I410T probably damaging Het
Ptpre A G 7: 135,679,235 N565S probably damaging Het
Rab44 T C 17: 29,145,270 L606P unknown Het
Rbm10 C T X: 20,637,664 probably benign Het
Rhd C T 4: 134,876,301 probably benign Het
Rspo3 T A 10: 29,499,921 probably benign Het
Sdccag8 T A 1: 176,946,144 N555K probably benign Het
Skint6 T A 4: 112,865,651 probably benign Het
Slc22a20 G A 19: 5,986,008 P45S probably damaging Het
Slc5a2 A G 7: 128,267,482 Y124C probably damaging Het
Taar8a T A 10: 24,077,077 I193N probably benign Het
Ten1 C T 11: 116,216,684 probably benign Het
Tfb2m T C 1: 179,545,833 E100G probably damaging Het
Tom1 C T 8: 75,052,306 probably benign Het
Vps52 G T 17: 33,960,011 R171L probably damaging Het
Zcwpw2 A T 9: 118,014,114 noncoding transcript Het
Zfhx4 G A 3: 5,403,820 E3013K probably damaging Het
Zfp777 C T 6: 48,029,360 V411M probably damaging Het
Other mutations in Spats2l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00771:Spats2l APN 1 57943072 missense probably damaging 1.00
IGL00788:Spats2l APN 1 57885705 missense probably damaging 1.00
IGL01627:Spats2l APN 1 57902082 splice site probably benign
IGL01758:Spats2l APN 1 57879556 missense probably damaging 1.00
IGL03395:Spats2l APN 1 57938016 missense probably damaging 1.00
P0033:Spats2l UTSW 1 57885838 missense probably damaging 0.99
R1167:Spats2l UTSW 1 57943111 missense probably damaging 1.00
R1486:Spats2l UTSW 1 57900811 missense probably damaging 0.99
R1564:Spats2l UTSW 1 57946224 missense probably damaging 1.00
R1938:Spats2l UTSW 1 57885782 missense probably benign 0.32
R2071:Spats2l UTSW 1 57940464 missense possibly damaging 0.90
R2096:Spats2l UTSW 1 57946299 missense probably benign 0.00
R2215:Spats2l UTSW 1 57946416 missense possibly damaging 0.82
R3053:Spats2l UTSW 1 57900766 missense probably damaging 1.00
R3784:Spats2l UTSW 1 57885779 missense probably damaging 0.99
R4814:Spats2l UTSW 1 57937926 missense possibly damaging 0.83
R4915:Spats2l UTSW 1 57902188 missense probably damaging 1.00
R4962:Spats2l UTSW 1 57885824 missense possibly damaging 0.88
R5022:Spats2l UTSW 1 57879556 missense probably damaging 1.00
R5068:Spats2l UTSW 1 57943221 missense probably benign
R5561:Spats2l UTSW 1 57900621 splice site probably null
R5773:Spats2l UTSW 1 57879549 missense possibly damaging 0.86
R5885:Spats2l UTSW 1 57946162 missense probably damaging 0.96
R6136:Spats2l UTSW 1 57902143 missense probably damaging 1.00
R6651:Spats2l UTSW 1 57946177 missense probably damaging 1.00
R6929:Spats2l UTSW 1 57879536 missense probably damaging 1.00
R7030:Spats2l UTSW 1 57879530 missense probably damaging 1.00
R7176:Spats2l UTSW 1 57937918 missense possibly damaging 0.89
R7274:Spats2l UTSW 1 57879513 nonsense probably null
R7342:Spats2l UTSW 1 57885947 missense possibly damaging 0.91
R7387:Spats2l UTSW 1 57902134 missense probably damaging 1.00
R7459:Spats2l UTSW 1 57799353 splice site probably benign
X0054:Spats2l UTSW 1 57943243 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TCCCTCCCCAGATAATGGAACCTG -3'
(R):5'- TTTCTCATCCTGTGTAGCAGCAGC -3'

Sequencing Primer
(F):5'- AACCAGTTCTTCCAGAGGTG -3'
(R):5'- TGTAGCAGCAGCAGCAAC -3'
Posted On2013-09-30