Incidental Mutation 'R0762:Sdccag8'
ID72433
Institutional Source Beutler Lab
Gene Symbol Sdccag8
Ensembl Gene ENSMUSG00000026504
Gene Nameserologically defined colon cancer antigen 8
SynonymsCCCAP, 2700048G21Rik, 5730470G24Rik
MMRRC Submission 038942-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0762 (G1)
Quality Score180
Status Validated
Chromosome1
Chromosomal Location176814660-177020437 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 176946144 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 555 (N555K)
Ref Sequence ENSEMBL: ENSMUSP00000027785 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027785] [ENSMUST00000123409]
Predicted Effect probably benign
Transcript: ENSMUST00000027785
AA Change: N555K

PolyPhen 2 Score 0.053 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000027785
Gene: ENSMUSG00000026504
AA Change: N555K

DomainStartEndE-ValueType
Pfam:CCCAP 6 710 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123409
SMART Domains Protein: ENSMUSP00000137948
Gene: ENSMUSG00000026504

DomainStartEndE-ValueType
low complexity region 92 105 N/A INTRINSIC
coiled coil region 132 168 N/A INTRINSIC
coiled coil region 228 278 N/A INTRINSIC
coiled coil region 307 327 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133305
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 93.9%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a centrosome associated protein. This protein may be involved in organizing the centrosome during interphase and mitosis. Mutations in this gene are associated with retinal-renal ciliopathy. [provided by RefSeq, Oct 2010]
PHENOTYPE: Homozygotes for a null allele show postnatal lethality, cleft palate, polydactyly, enlarged lateral ventricles and impaired neuronal migration. Homozygotes for a gene trap allele show late-onset nephronophthisis associated with renal cysts and fibrosis, and retinal degeneration leading to blindness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik A G 15: 8,218,416 probably benign Het
4921504E06Rik T A 2: 19,477,856 N475I probably damaging Het
Adar T C 3: 89,739,983 probably benign Het
Aldh3b3 A T 19: 3,965,747 probably null Het
Amtn C T 5: 88,385,000 T158I possibly damaging Het
Ap1g2 A G 14: 55,100,411 probably benign Het
Arhgef3 A G 14: 27,397,627 Y318C probably damaging Het
Atg2b A C 12: 105,674,970 V69G possibly damaging Het
Bbx G A 16: 50,225,166 T236I possibly damaging Het
Bcl11b C T 12: 107,965,663 probably benign Het
Catsperg1 T C 7: 29,189,952 I794V probably benign Het
Ccdc88a C T 11: 29,463,112 probably benign Het
Cdhr3 C A 12: 33,060,301 R328L probably benign Het
Ces2e T A 8: 104,929,864 M242K probably damaging Het
Col12a1 A G 9: 79,681,374 probably benign Het
Col3a1 T C 1: 45,321,526 S39P unknown Het
Cyp2a5 T A 7: 26,838,873 Y220* probably null Het
D3Ertd254e G A 3: 36,165,867 D680N possibly damaging Het
Dcc T A 18: 71,342,705 probably benign Het
Dnajb8 A G 6: 88,223,054 T191A probably damaging Het
Ephx2 A T 14: 66,102,179 F199I probably damaging Het
Fancd2 A G 6: 113,574,658 K1062E probably benign Het
Fbxo33 A G 12: 59,204,499 V410A probably benign Het
Gars T G 6: 55,077,580 probably null Het
Git1 A C 11: 77,499,834 D132A possibly damaging Het
Gm853 A G 4: 130,221,624 S44P probably damaging Het
Gp1ba C T 11: 70,641,427 P673L probably damaging Het
Gucy1a1 T C 3: 82,094,896 T44A unknown Het
Hjurp G C 1: 88,277,215 probably benign Het
Ifnlr1 A G 4: 135,701,329 K156E possibly damaging Het
Klf13 T C 7: 63,891,623 N15S probably benign Het
Krt77 T C 15: 101,861,126 probably null Het
Map4 C A 9: 110,038,478 probably benign Het
Mthfr T C 4: 148,055,443 I623T possibly damaging Het
Myo7b T A 18: 31,983,944 T908S probably benign Het
Nbeal2 T G 9: 110,643,808 probably benign Het
Nwd2 T G 5: 63,800,414 F362L probably benign Het
Pcm1 A T 8: 41,261,020 R208W probably damaging Het
Pkd2l1 T C 19: 44,150,470 D647G probably benign Het
Plbd1 C T 6: 136,641,147 V24M probably damaging Het
Polr2a G A 11: 69,735,117 P1698S unknown Het
Prss12 T C 3: 123,485,504 I410T probably damaging Het
Ptpre A G 7: 135,679,235 N565S probably damaging Het
Rab44 T C 17: 29,145,270 L606P unknown Het
Rbm10 C T X: 20,637,664 probably benign Het
Rhd C T 4: 134,876,301 probably benign Het
Rspo3 T A 10: 29,499,921 probably benign Het
Skint6 T A 4: 112,865,651 probably benign Het
Slc22a20 G A 19: 5,986,008 P45S probably damaging Het
Slc5a2 A G 7: 128,267,482 Y124C probably damaging Het
Spats2l T C 1: 57,885,884 L127P possibly damaging Het
Taar8a T A 10: 24,077,077 I193N probably benign Het
Ten1 C T 11: 116,216,684 probably benign Het
Tfb2m T C 1: 179,545,833 E100G probably damaging Het
Tom1 C T 8: 75,052,306 probably benign Het
Vps52 G T 17: 33,960,011 R171L probably damaging Het
Zcwpw2 A T 9: 118,014,114 noncoding transcript Het
Zfhx4 G A 3: 5,403,820 E3013K probably damaging Het
Zfp777 C T 6: 48,029,360 V411M probably damaging Het
Other mutations in Sdccag8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00951:Sdccag8 APN 1 176878002 missense possibly damaging 0.67
IGL01446:Sdccag8 APN 1 176845245 missense probably damaging 1.00
IGL01794:Sdccag8 APN 1 176845307 missense possibly damaging 0.69
IGL02179:Sdccag8 APN 1 176878056 missense probably benign 0.19
IGL02313:Sdccag8 APN 1 176824755 missense possibly damaging 0.48
IGL02962:Sdccag8 APN 1 176948362 missense probably damaging 1.00
R0433:Sdccag8 UTSW 1 176844821 splice site probably null
R1928:Sdccag8 UTSW 1 176828970 missense probably damaging 1.00
R2132:Sdccag8 UTSW 1 176955889 missense probably damaging 1.00
R2342:Sdccag8 UTSW 1 176919641 missense probably benign 0.26
R2964:Sdccag8 UTSW 1 176948371 missense possibly damaging 0.93
R3800:Sdccag8 UTSW 1 176868338 nonsense probably null
R3853:Sdccag8 UTSW 1 176853795 missense probably damaging 1.00
R4409:Sdccag8 UTSW 1 176868366 critical splice donor site probably null
R4590:Sdccag8 UTSW 1 176948292 missense probably damaging 1.00
R5036:Sdccag8 UTSW 1 177011975 missense probably damaging 0.99
R5083:Sdccag8 UTSW 1 176824892 missense probably damaging 1.00
R5174:Sdccag8 UTSW 1 176845350 missense probably damaging 0.99
R5739:Sdccag8 UTSW 1 176826231 missense probably benign 0.00
R5740:Sdccag8 UTSW 1 176831150 missense probably benign 0.02
R5898:Sdccag8 UTSW 1 176824822 missense probably benign 0.09
R6435:Sdccag8 UTSW 1 176814862 unclassified probably benign
R6624:Sdccag8 UTSW 1 176874812 intron probably null
R6763:Sdccag8 UTSW 1 176854627 intron probably null
R6877:Sdccag8 UTSW 1 177011935 missense probably damaging 1.00
R7130:Sdccag8 UTSW 1 176874601 missense probably damaging 0.97
R7331:Sdccag8 UTSW 1 176868290 missense possibly damaging 0.91
R7393:Sdccag8 UTSW 1 176840306 missense probably benign 0.00
X0024:Sdccag8 UTSW 1 176919629 missense probably damaging 1.00
Z1176:Sdccag8 UTSW 1 176868231 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCCTGCAAAATGGGGAGACTACAG -3'
(R):5'- CTCTCAAGTCAACAGACAGTGGGC -3'

Sequencing Primer
(F):5'- CAGAAAGATTAGCTACTGCTGC -3'
(R):5'- GCCAAAGGTTACAGGTGTTCC -3'
Posted On2013-09-30