Incidental Mutation 'R9612:Golgb1'
ID 724351
Institutional Source Beutler Lab
Gene Symbol Golgb1
Ensembl Gene ENSMUSG00000034243
Gene Name golgin B1
Synonyms C130074L01Rik, Gm6840, F730017E11Rik, Giantin, 6330407A06Rik
MMRRC Submission
Accession Numbers
Essential gene? Probably essential (E-score: 0.918) question?
Stock # R9612 (G1)
Quality Score 225.009
Status Not validated
Chromosome 16
Chromosomal Location 36695502-36753447 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 36739967 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 2810 (V2810M)
Ref Sequence ENSEMBL: ENSMUSP00000045239 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039855] [ENSMUST00000114812]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000039855
AA Change: V2810M

PolyPhen 2 Score 0.412 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000045239
Gene: ENSMUSG00000034243
AA Change: V2810M

DomainStartEndE-ValueType
internal_repeat_2 24 61 7.47e-6 PROSPERO
low complexity region 87 107 N/A INTRINSIC
coiled coil region 130 219 N/A INTRINSIC
low complexity region 491 512 N/A INTRINSIC
internal_repeat_3 519 558 7.47e-6 PROSPERO
coiled coil region 563 594 N/A INTRINSIC
internal_repeat_4 627 661 3.38e-5 PROSPERO
coiled coil region 679 1121 N/A INTRINSIC
coiled coil region 1153 1240 N/A INTRINSIC
internal_repeat_4 1253 1288 3.38e-5 PROSPERO
low complexity region 1300 1314 N/A INTRINSIC
internal_repeat_1 1321 1352 3.51e-6 PROSPERO
low complexity region 1357 1369 N/A INTRINSIC
coiled coil region 1402 1755 N/A INTRINSIC
internal_repeat_2 1760 1798 7.47e-6 PROSPERO
internal_repeat_3 1761 1804 7.47e-6 PROSPERO
coiled coil region 1818 2034 N/A INTRINSIC
low complexity region 2291 2306 N/A INTRINSIC
internal_repeat_1 2351 2382 3.51e-6 PROSPERO
low complexity region 2400 2418 N/A INTRINSIC
low complexity region 2538 2549 N/A INTRINSIC
coiled coil region 2775 2827 N/A INTRINSIC
coiled coil region 2854 2943 N/A INTRINSIC
low complexity region 2964 2976 N/A INTRINSIC
coiled coil region 3007 3057 N/A INTRINSIC
coiled coil region 3117 3163 N/A INTRINSIC
transmembrane domain 3215 3237 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114812
AA Change: V2769M

PolyPhen 2 Score 0.412 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000110460
Gene: ENSMUSG00000034243
AA Change: V2769M

DomainStartEndE-ValueType
internal_repeat_2 24 61 6.71e-6 PROSPERO
low complexity region 87 107 N/A INTRINSIC
low complexity region 120 134 N/A INTRINSIC
low complexity region 143 154 N/A INTRINSIC
low complexity region 200 219 N/A INTRINSIC
low complexity region 450 471 N/A INTRINSIC
internal_repeat_3 478 517 6.71e-6 PROSPERO
coiled coil region 522 553 N/A INTRINSIC
internal_repeat_4 586 620 3.05e-5 PROSPERO
coiled coil region 638 1080 N/A INTRINSIC
coiled coil region 1112 1199 N/A INTRINSIC
internal_repeat_4 1212 1247 3.05e-5 PROSPERO
low complexity region 1259 1273 N/A INTRINSIC
internal_repeat_1 1280 1311 3.14e-6 PROSPERO
low complexity region 1316 1328 N/A INTRINSIC
coiled coil region 1361 1714 N/A INTRINSIC
internal_repeat_2 1719 1757 6.71e-6 PROSPERO
internal_repeat_3 1720 1763 6.71e-6 PROSPERO
coiled coil region 1777 1993 N/A INTRINSIC
low complexity region 2250 2265 N/A INTRINSIC
internal_repeat_1 2310 2341 3.14e-6 PROSPERO
low complexity region 2359 2377 N/A INTRINSIC
low complexity region 2497 2508 N/A INTRINSIC
coiled coil region 2734 2786 N/A INTRINSIC
coiled coil region 2813 2902 N/A INTRINSIC
low complexity region 2923 2935 N/A INTRINSIC
coiled coil region 2966 3016 N/A INTRINSIC
coiled coil region 3076 3122 N/A INTRINSIC
transmembrane domain 3174 3196 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous knockout affects glycosylation of glycoproteins in the extra-cellular matrix of the palatal shelves, resulting in their failure to elevate and fuse, leading to cleft palate. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted, other(2) Gene trapped(5)

Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik T C 7: 41,276,327 (GRCm39) S677P possibly damaging Het
5730480H06Rik A G 5: 48,531,872 (GRCm39) I67V probably benign Het
Adam15 T A 3: 89,249,247 (GRCm39) Y736F probably damaging Het
Adam29 A T 8: 56,325,118 (GRCm39) F445L possibly damaging Het
Adgrv1 A G 13: 81,641,082 (GRCm39) Y3318H probably damaging Het
Akap6 A G 12: 52,958,690 (GRCm39) Y815C probably damaging Het
Ankar T A 1: 72,704,294 (GRCm39) D876V possibly damaging Het
Atp6v1g2 G A 17: 35,456,733 (GRCm39) V106I probably benign Het
Bdp1 A G 13: 100,214,370 (GRCm39) S490P probably benign Het
Bet1 A T 6: 4,077,918 (GRCm39) V107D probably damaging Het
Bri3bp T C 5: 125,531,390 (GRCm39) V112A probably damaging Het
Cage1 T A 13: 38,216,351 (GRCm39) D33V probably damaging Het
Ccdc146 G T 5: 21,535,577 (GRCm39) A159E probably damaging Het
Ccnl1 C A 3: 65,865,404 (GRCm39) G49V probably damaging Het
Cdk13 A C 13: 17,926,440 (GRCm39) F787V Het
Cdk5r1 T C 11: 80,368,480 (GRCm39) V49A probably benign Het
Cdon G A 9: 35,398,201 (GRCm39) V973I probably damaging Het
Cfap298 A T 16: 90,724,275 (GRCm39) M166K probably benign Het
Chd1l T A 3: 97,488,463 (GRCm39) K518* probably null Het
Col24a1 A G 3: 145,250,960 (GRCm39) D1653G probably benign Het
Cstf3 G T 2: 104,483,370 (GRCm39) V359F possibly damaging Het
Dchs2 T C 3: 83,178,193 (GRCm39) I1082T probably damaging Het
Dlec1 A T 9: 118,956,533 (GRCm39) I736F probably damaging Het
Dnah9 T C 11: 65,818,475 (GRCm39) N3288D probably benign Het
Dpcd G T 19: 45,560,422 (GRCm39) E82* probably null Het
Ehbp1 T C 11: 22,119,124 (GRCm39) D182G probably damaging Het
Eif1ad13 A G 12: 87,762,507 (GRCm39) I76V probably benign Het
Evc2 G T 5: 37,544,130 (GRCm39) E626D probably benign Het
Evi5 T C 5: 107,943,578 (GRCm39) E589G probably benign Het
Exoc4 T C 6: 33,226,161 (GRCm39) I25T probably benign Het
Extl2 T A 3: 115,821,145 (GRCm39) *331R probably null Het
Fkbp8 G A 8: 70,984,324 (GRCm39) R225H probably damaging Het
Foxred2 A T 15: 77,836,206 (GRCm39) S384T probably damaging Het
Garre1 A T 7: 33,947,656 (GRCm39) C451S probably damaging Het
Glmn T C 5: 107,741,731 (GRCm39) E18G probably damaging Het
Gm7489 A C 15: 53,749,369 (GRCm39) Q147P unknown Het
Gm7489 C A 15: 53,749,368 (GRCm39) Q147K unknown Het
Gm8005 T A 14: 42,260,355 (GRCm39) I94F Het
Gpr21 T C 2: 37,408,399 (GRCm39) L315P probably damaging Het
Grip1 G A 10: 119,874,569 (GRCm39) E778K possibly damaging Het
Herc6 T G 6: 57,629,017 (GRCm39) S643A probably benign Het
Igkv14-100 T A 6: 68,496,317 (GRCm39) I70N probably damaging Het
Kcnn3 A G 3: 89,516,703 (GRCm39) M371V probably benign Het
Kif1a T A 1: 92,953,416 (GRCm39) H1256L probably damaging Het
Klhdc4 A G 8: 122,527,917 (GRCm39) S266P possibly damaging Het
Kmt2d CTGTTG CTG 15: 98,743,057 (GRCm39) probably benign Het
Lefty2 T A 1: 180,722,286 (GRCm39) L208Q probably damaging Het
Lingo2 T C 4: 35,708,450 (GRCm39) Y510C probably damaging Het
Lrif1 T A 3: 106,639,200 (GRCm39) V70D probably damaging Het
Lrrc74a A T 12: 86,805,345 (GRCm39) K389I possibly damaging Het
Megf8 A T 7: 25,054,488 (GRCm39) E1868V probably benign Het
Mmp1a TG TGG 9: 7,465,083 (GRCm38) probably null Het
Mmp8 A G 9: 7,560,608 (GRCm39) D95G probably damaging Het
Mmrn1 T A 6: 60,953,408 (GRCm39) I563N probably damaging Het
Mroh3 T C 1: 136,118,713 (GRCm39) T535A probably benign Het
Mroh9 A G 1: 162,866,498 (GRCm39) L715P probably damaging Het
Myh6 G T 14: 55,201,054 (GRCm39) A136E probably benign Het
Myom1 G T 17: 71,412,475 (GRCm39) E1231* probably null Het
Nod2 G T 8: 89,397,101 (GRCm39) C837F probably benign Het
Nos2 T A 11: 78,839,984 (GRCm39) W698R probably damaging Het
Nup210l C T 3: 90,107,173 (GRCm39) P1570L probably benign Het
Oas1a A T 5: 121,040,028 (GRCm39) S188T possibly damaging Het
Ogfr GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG 2: 180,237,059 (GRCm39) probably benign Het
Opa1 T C 16: 29,430,255 (GRCm39) M394T Het
Or1e1d-ps1 T A 11: 73,819,375 (GRCm39) D108E possibly damaging Het
Or5an6 A T 19: 12,371,983 (GRCm39) M119L probably damaging Het
Or5p66 A G 7: 107,885,487 (GRCm39) M282T probably benign Het
Or7g21 T A 9: 19,032,760 (GRCm39) S167T probably benign Het
Or7g29 A G 9: 19,286,677 (GRCm39) S167P possibly damaging Het
Oxct2a T A 4: 123,217,129 (GRCm39) D84V probably damaging Het
Oxct2b A C 4: 123,011,019 (GRCm39) D313A probably damaging Het
Phldb3 G A 7: 24,328,372 (GRCm39) V639M probably damaging Het
Plppr4 T A 3: 117,115,610 (GRCm39) N749I probably benign Het
Pmp22 G T 11: 63,024,065 (GRCm39) V25F probably benign Het
Pofut2 A T 10: 77,101,763 (GRCm39) M267L probably benign Het
Ppp1r42 T A 1: 10,039,067 (GRCm39) N351I possibly damaging Het
Prl2b1 T C 13: 27,572,479 (GRCm39) E37G probably benign Het
Ptpro G T 6: 137,391,318 (GRCm39) V813F probably benign Het
Rnaseh2c T C 19: 5,652,343 (GRCm39) F99L probably benign Het
Scn9a T A 2: 66,363,708 (GRCm39) I857F probably damaging Het
Slf1 A G 13: 77,197,204 (GRCm39) probably null Het
Smyd2 T C 1: 189,612,983 (GRCm39) *434W probably null Het
Spata31h1 T A 10: 82,125,453 (GRCm39) N2519I possibly damaging Het
Stk40 A G 4: 126,030,650 (GRCm39) D290G probably damaging Het
Tdo2 C A 3: 81,879,001 (GRCm39) W82C probably damaging Het
Tmem101 A G 11: 102,044,194 (GRCm39) V231A probably damaging Het
Tns2 G A 15: 102,015,577 (GRCm39) E160K probably damaging Het
Trim31 A T 17: 37,212,551 (GRCm39) D174V probably benign Het
Unc13d A T 11: 115,961,144 (GRCm39) Y404* probably null Het
Ush2a C A 1: 188,092,063 (GRCm39) Y531* probably null Het
Vapa G A 17: 65,889,736 (GRCm39) P144S probably benign Het
Vmn1r212 C T 13: 23,067,443 (GRCm39) V297M possibly damaging Het
Vmn2r80 A C 10: 79,030,712 (GRCm39) N846T probably damaging Het
Zfp811 A G 17: 33,017,740 (GRCm39) V100A probably benign Het
Zfp958 T A 8: 4,678,298 (GRCm39) C108S probably damaging Het
Zic5 G A 14: 122,697,100 (GRCm39) T505I unknown Het
Other mutations in Golgb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01394:Golgb1 APN 16 36,751,926 (GRCm39) missense probably damaging 1.00
IGL01717:Golgb1 APN 16 36,735,864 (GRCm39) nonsense probably null
IGL01965:Golgb1 APN 16 36,738,282 (GRCm39) missense probably damaging 1.00
IGL02128:Golgb1 APN 16 36,736,666 (GRCm39) missense probably damaging 1.00
IGL02268:Golgb1 APN 16 36,733,490 (GRCm39) missense probably benign 0.25
IGL02383:Golgb1 APN 16 36,706,562 (GRCm39) missense probably benign 0.01
IGL02444:Golgb1 APN 16 36,728,178 (GRCm39) splice site probably benign
IGL02635:Golgb1 APN 16 36,735,375 (GRCm39) missense probably benign 0.00
IGL02655:Golgb1 APN 16 36,738,442 (GRCm39) missense probably damaging 0.98
IGL02887:Golgb1 APN 16 36,746,211 (GRCm39) missense probably damaging 0.99
IGL02937:Golgb1 APN 16 36,736,572 (GRCm39) missense probably damaging 1.00
IGL02973:Golgb1 APN 16 36,732,442 (GRCm39) missense possibly damaging 0.92
IGL02982:Golgb1 APN 16 36,746,172 (GRCm39) missense probably damaging 0.98
IGL03065:Golgb1 APN 16 36,733,228 (GRCm39) missense probably benign 0.11
IGL03109:Golgb1 APN 16 36,735,973 (GRCm39) missense possibly damaging 0.93
IGL03323:Golgb1 APN 16 36,733,815 (GRCm39) nonsense probably null
I2288:Golgb1 UTSW 16 36,718,904 (GRCm39) missense probably benign 0.00
I2289:Golgb1 UTSW 16 36,718,904 (GRCm39) missense probably benign 0.00
R0071:Golgb1 UTSW 16 36,735,865 (GRCm39) missense probably benign 0.00
R0071:Golgb1 UTSW 16 36,735,865 (GRCm39) missense probably benign 0.00
R0080:Golgb1 UTSW 16 36,718,973 (GRCm39) missense probably damaging 1.00
R0102:Golgb1 UTSW 16 36,695,830 (GRCm39) intron probably benign
R0242:Golgb1 UTSW 16 36,695,992 (GRCm39) nonsense probably null
R0242:Golgb1 UTSW 16 36,695,992 (GRCm39) nonsense probably null
R0276:Golgb1 UTSW 16 36,734,238 (GRCm39) missense probably damaging 1.00
R0394:Golgb1 UTSW 16 36,695,941 (GRCm39) intron probably benign
R0469:Golgb1 UTSW 16 36,751,997 (GRCm39) missense probably benign 0.41
R0522:Golgb1 UTSW 16 36,735,567 (GRCm39) frame shift probably null
R0575:Golgb1 UTSW 16 36,739,171 (GRCm39) missense probably benign
R0600:Golgb1 UTSW 16 36,736,633 (GRCm39) missense probably damaging 1.00
R0608:Golgb1 UTSW 16 36,736,692 (GRCm39) nonsense probably null
R0711:Golgb1 UTSW 16 36,739,152 (GRCm39) missense probably damaging 1.00
R0785:Golgb1 UTSW 16 36,719,152 (GRCm39) missense possibly damaging 0.95
R0893:Golgb1 UTSW 16 36,732,639 (GRCm39) missense possibly damaging 0.64
R1163:Golgb1 UTSW 16 36,736,488 (GRCm39) missense possibly damaging 0.50
R1208:Golgb1 UTSW 16 36,735,567 (GRCm39) frame shift probably null
R1315:Golgb1 UTSW 16 36,735,262 (GRCm39) missense probably benign 0.40
R1429:Golgb1 UTSW 16 36,720,925 (GRCm39) missense possibly damaging 0.93
R1505:Golgb1 UTSW 16 36,740,005 (GRCm39) missense possibly damaging 0.79
R1537:Golgb1 UTSW 16 36,719,150 (GRCm39) missense possibly damaging 0.89
R1610:Golgb1 UTSW 16 36,746,463 (GRCm39) missense probably benign 0.25
R1659:Golgb1 UTSW 16 36,707,979 (GRCm39) missense probably benign 0.01
R1769:Golgb1 UTSW 16 36,736,363 (GRCm39) missense probably damaging 1.00
R2105:Golgb1 UTSW 16 36,735,026 (GRCm39) missense probably benign
R2212:Golgb1 UTSW 16 36,707,709 (GRCm39) missense probably damaging 1.00
R2261:Golgb1 UTSW 16 36,713,722 (GRCm39) missense probably damaging 1.00
R2352:Golgb1 UTSW 16 36,718,921 (GRCm39) missense probably damaging 0.99
R2357:Golgb1 UTSW 16 36,732,370 (GRCm39) missense probably damaging 1.00
R2400:Golgb1 UTSW 16 36,738,828 (GRCm39) missense possibly damaging 0.62
R2513:Golgb1 UTSW 16 36,735,513 (GRCm39) missense possibly damaging 0.73
R3103:Golgb1 UTSW 16 36,715,211 (GRCm39) missense probably damaging 1.00
R3413:Golgb1 UTSW 16 36,707,709 (GRCm39) missense probably damaging 1.00
R3748:Golgb1 UTSW 16 36,739,274 (GRCm39) missense probably benign 0.00
R3847:Golgb1 UTSW 16 36,719,095 (GRCm39) missense probably benign 0.00
R3850:Golgb1 UTSW 16 36,719,095 (GRCm39) missense probably benign 0.00
R3936:Golgb1 UTSW 16 36,734,418 (GRCm39) nonsense probably null
R3975:Golgb1 UTSW 16 36,738,933 (GRCm39) missense probably damaging 0.99
R4025:Golgb1 UTSW 16 36,735,706 (GRCm39) missense probably benign 0.00
R4369:Golgb1 UTSW 16 36,737,269 (GRCm39) missense probably damaging 1.00
R4518:Golgb1 UTSW 16 36,749,625 (GRCm39) missense probably damaging 0.98
R4600:Golgb1 UTSW 16 36,738,987 (GRCm39) missense probably damaging 1.00
R4610:Golgb1 UTSW 16 36,738,987 (GRCm39) missense probably damaging 1.00
R4660:Golgb1 UTSW 16 36,707,980 (GRCm39) missense probably damaging 0.99
R4811:Golgb1 UTSW 16 36,711,781 (GRCm39) missense probably damaging 1.00
R4815:Golgb1 UTSW 16 36,733,477 (GRCm39) missense possibly damaging 0.79
R4835:Golgb1 UTSW 16 36,711,769 (GRCm39) missense possibly damaging 0.86
R4904:Golgb1 UTSW 16 36,713,748 (GRCm39) missense probably damaging 1.00
R4916:Golgb1 UTSW 16 36,736,480 (GRCm39) missense probably benign 0.05
R5121:Golgb1 UTSW 16 36,739,620 (GRCm39) missense probably damaging 0.99
R5133:Golgb1 UTSW 16 36,711,819 (GRCm39) missense possibly damaging 0.75
R5143:Golgb1 UTSW 16 36,719,051 (GRCm39) missense probably benign 0.09
R5185:Golgb1 UTSW 16 36,695,503 (GRCm39) unclassified probably benign
R5188:Golgb1 UTSW 16 36,738,827 (GRCm39) missense probably benign 0.13
R5260:Golgb1 UTSW 16 36,733,503 (GRCm39) missense probably benign 0.00
R5297:Golgb1 UTSW 16 36,695,978 (GRCm39) intron probably benign
R5386:Golgb1 UTSW 16 36,732,677 (GRCm39) nonsense probably null
R5438:Golgb1 UTSW 16 36,720,870 (GRCm39) missense probably benign 0.15
R5439:Golgb1 UTSW 16 36,720,870 (GRCm39) missense probably benign 0.15
R5494:Golgb1 UTSW 16 36,749,045 (GRCm39) missense possibly damaging 0.67
R5592:Golgb1 UTSW 16 36,746,125 (GRCm39) missense probably benign 0.02
R5740:Golgb1 UTSW 16 36,739,362 (GRCm39) missense probably damaging 0.99
R5862:Golgb1 UTSW 16 36,746,453 (GRCm39) splice site silent
R5928:Golgb1 UTSW 16 36,732,349 (GRCm39) missense probably damaging 1.00
R6009:Golgb1 UTSW 16 36,735,321 (GRCm39) missense probably damaging 1.00
R6062:Golgb1 UTSW 16 36,735,033 (GRCm39) missense possibly damaging 0.89
R6102:Golgb1 UTSW 16 36,733,227 (GRCm39) missense probably damaging 1.00
R6198:Golgb1 UTSW 16 36,713,757 (GRCm39) missense probably damaging 1.00
R6253:Golgb1 UTSW 16 36,735,984 (GRCm39) missense possibly damaging 0.77
R6254:Golgb1 UTSW 16 36,734,340 (GRCm39) missense probably damaging 0.99
R6321:Golgb1 UTSW 16 36,738,559 (GRCm39) nonsense probably null
R6700:Golgb1 UTSW 16 36,695,946 (GRCm39) intron probably benign
R6870:Golgb1 UTSW 16 36,738,565 (GRCm39) missense probably damaging 1.00
R6882:Golgb1 UTSW 16 36,734,352 (GRCm39) missense probably benign
R6944:Golgb1 UTSW 16 36,732,475 (GRCm39) missense probably benign
R7108:Golgb1 UTSW 16 36,734,083 (GRCm39) missense probably benign 0.01
R7124:Golgb1 UTSW 16 36,734,035 (GRCm39) missense probably benign 0.01
R7125:Golgb1 UTSW 16 36,738,325 (GRCm39) missense possibly damaging 0.85
R7187:Golgb1 UTSW 16 36,736,512 (GRCm39) missense probably benign 0.43
R7205:Golgb1 UTSW 16 36,695,663 (GRCm39) missense unknown
R7206:Golgb1 UTSW 16 36,734,111 (GRCm39) missense probably benign 0.41
R7233:Golgb1 UTSW 16 36,735,120 (GRCm39) missense possibly damaging 0.91
R7320:Golgb1 UTSW 16 36,736,313 (GRCm39) nonsense probably null
R7367:Golgb1 UTSW 16 36,718,908 (GRCm39) missense probably benign 0.00
R7408:Golgb1 UTSW 16 36,718,909 (GRCm39) missense probably damaging 0.98
R7419:Golgb1 UTSW 16 36,733,281 (GRCm39) missense possibly damaging 0.95
R7556:Golgb1 UTSW 16 36,736,155 (GRCm39) missense probably benign 0.03
R7599:Golgb1 UTSW 16 36,695,758 (GRCm39) missense unknown
R7673:Golgb1 UTSW 16 36,734,031 (GRCm39) missense probably benign 0.05
R7789:Golgb1 UTSW 16 36,695,761 (GRCm39) missense unknown
R7792:Golgb1 UTSW 16 36,739,092 (GRCm39) missense probably benign 0.43
R7830:Golgb1 UTSW 16 36,719,083 (GRCm39) missense possibly damaging 0.93
R7847:Golgb1 UTSW 16 36,752,282 (GRCm39) missense probably damaging 1.00
R7905:Golgb1 UTSW 16 36,734,047 (GRCm39) missense probably benign
R7944:Golgb1 UTSW 16 36,734,466 (GRCm39) missense probably benign 0.02
R7945:Golgb1 UTSW 16 36,734,466 (GRCm39) missense probably benign 0.02
R7950:Golgb1 UTSW 16 36,735,786 (GRCm39) missense probably benign 0.13
R8040:Golgb1 UTSW 16 36,733,841 (GRCm39) missense possibly damaging 0.85
R8077:Golgb1 UTSW 16 36,738,995 (GRCm39) missense probably damaging 0.99
R8181:Golgb1 UTSW 16 36,737,192 (GRCm39) missense probably damaging 1.00
R8370:Golgb1 UTSW 16 36,732,679 (GRCm39) missense probably benign 0.00
R8684:Golgb1 UTSW 16 36,734,764 (GRCm39) missense possibly damaging 0.92
R8725:Golgb1 UTSW 16 36,739,563 (GRCm39) missense probably damaging 1.00
R8727:Golgb1 UTSW 16 36,739,563 (GRCm39) missense probably damaging 1.00
R8738:Golgb1 UTSW 16 36,736,675 (GRCm39) missense probably damaging 1.00
R8785:Golgb1 UTSW 16 36,740,106 (GRCm39) missense probably damaging 0.99
R8824:Golgb1 UTSW 16 36,736,051 (GRCm39) missense probably benign
R8825:Golgb1 UTSW 16 36,739,809 (GRCm39) missense probably benign 0.00
R8940:Golgb1 UTSW 16 36,736,759 (GRCm39) missense probably damaging 1.00
R8962:Golgb1 UTSW 16 36,733,978 (GRCm39) missense probably damaging 1.00
R9245:Golgb1 UTSW 16 36,739,181 (GRCm39) nonsense probably null
R9365:Golgb1 UTSW 16 36,736,124 (GRCm39) missense probably damaging 1.00
R9620:Golgb1 UTSW 16 36,739,811 (GRCm39) missense probably benign
R9691:Golgb1 UTSW 16 36,718,996 (GRCm39) missense probably damaging 1.00
R9747:Golgb1 UTSW 16 36,713,769 (GRCm39) missense probably damaging 1.00
V1662:Golgb1 UTSW 16 36,718,904 (GRCm39) missense probably benign 0.00
X0067:Golgb1 UTSW 16 36,734,665 (GRCm39) nonsense probably null
Z1088:Golgb1 UTSW 16 36,740,104 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGAAAGAGTGGCAGGACTC -3'
(R):5'- ATCCATGTGAAGAATGGCCC -3'

Sequencing Primer
(F):5'- GTGGCAGGACTCAAGCAG -3'
(R):5'- ATCTCTGTCATTCTGGAGTGAAGAC -3'
Posted On 2022-09-12