Incidental Mutation 'R9612:Myom1'
ID 724357
Institutional Source Beutler Lab
Gene Symbol Myom1
Ensembl Gene ENSMUSG00000024049
Gene Name myomesin 1
Synonyms skelemin, D430047A17Rik
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9612 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 71019521-71126856 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) G to T at 71105480 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 1231 (E1231*)
Ref Sequence ENSEMBL: ENSMUSP00000072945 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024847] [ENSMUST00000073211] [ENSMUST00000179759]
AlphaFold Q62234
PDB Structure Skelemin Immunoglobulin C2 like domain 4 [SOLUTION NMR]
Skelemin Association with alfa2b,betta3 Integrin: A Structural Model [SOLUTION NMR]
Predicted Effect probably null
Transcript: ENSMUST00000024847
AA Change: E1133*
SMART Domains Protein: ENSMUSP00000024847
Gene: ENSMUSG00000024049
AA Change: E1133*

DomainStartEndE-ValueType
low complexity region 62 94 N/A INTRINSIC
low complexity region 188 210 N/A INTRINSIC
low complexity region 228 244 N/A INTRINSIC
IG 264 351 1.16e-8 SMART
IG 397 480 5.84e-5 SMART
FN3 490 573 4.48e-13 SMART
FN3 618 701 1.61e-14 SMART
FN3 719 800 1.43e-11 SMART
FN3 818 904 4.99e-11 SMART
FN3 923 1008 2.04e-16 SMART
IG 1025 1110 3.1e0 SMART
IG_like 1133 1219 1.34e1 SMART
IG_like 1253 1319 4.79e0 SMART
IG_like 1356 1433 1.54e2 SMART
IGc2 1469 1537 2.05e-9 SMART
Predicted Effect probably null
Transcript: ENSMUST00000073211
AA Change: E1231*
SMART Domains Protein: ENSMUSP00000072945
Gene: ENSMUSG00000024049
AA Change: E1231*

DomainStartEndE-ValueType
low complexity region 62 94 N/A INTRINSIC
low complexity region 188 210 N/A INTRINSIC
low complexity region 228 244 N/A INTRINSIC
IG 264 351 1.16e-8 SMART
IG 397 480 5.84e-5 SMART
FN3 490 573 4.48e-13 SMART
FN3 618 701 1.61e-14 SMART
FN3 719 800 1.43e-11 SMART
low complexity region 857 870 N/A INTRINSIC
FN3 916 1002 4.99e-11 SMART
FN3 1021 1106 2.04e-16 SMART
IG 1123 1208 3.1e0 SMART
IG_like 1231 1317 1.34e1 SMART
IG_like 1351 1417 4.79e0 SMART
IG_like 1454 1531 1.54e2 SMART
IGc2 1567 1635 2.05e-9 SMART
Predicted Effect probably null
Transcript: ENSMUST00000179759
AA Change: E1133*
SMART Domains Protein: ENSMUSP00000136266
Gene: ENSMUSG00000024049
AA Change: E1133*

DomainStartEndE-ValueType
low complexity region 62 94 N/A INTRINSIC
low complexity region 188 210 N/A INTRINSIC
low complexity region 228 244 N/A INTRINSIC
IG 264 351 1.16e-8 SMART
IG 397 480 5.84e-5 SMART
FN3 490 573 4.48e-13 SMART
FN3 618 701 1.61e-14 SMART
FN3 719 800 1.43e-11 SMART
FN3 818 904 4.99e-11 SMART
FN3 923 1008 2.04e-16 SMART
IG 1025 1110 3.1e0 SMART
IG_like 1133 1219 1.34e1 SMART
IG_like 1253 1319 4.79e0 SMART
IG_like 1356 1433 1.54e2 SMART
IGc2 1469 1537 2.05e-9 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The giant protein titin, together with its associated proteins, interconnects the major structure of sarcomeres, the M bands and Z discs. The C-terminal end of the titin string extends into the M line, where it binds tightly to M-band constituents of apparent molecular masses of 190 kD (myomesin 1) and 165 kD (myomesin 2). This protein, myomesin 1, like myomesin 2, titin, and other myofibrillar proteins contains structural modules with strong homology to either fibronectin type III (motif I) or immunoglobulin C2 (motif II) domains. Myomesin 1 and myomesin 2 each have a unique N-terminal region followed by 12 modules of motif I or motif II, in the arrangement II-II-I-I-I-I-I-II-II-II-II-II. The two proteins share 50% sequence identity in this repeat-containing region. The head structure formed by these 2 proteins on one end of the titin string extends into the center of the M band. The integrating structure of the sarcomere arises from muscle-specific members of the superfamily of immunoglobulin-like proteins. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik T C 7: 41,626,903 (GRCm38) S677P possibly damaging Het
5730480H06Rik A G 5: 48,374,530 (GRCm38) I67V probably benign Het
Adam15 T A 3: 89,341,940 (GRCm38) Y736F probably damaging Het
Adam29 A T 8: 55,872,083 (GRCm38) F445L possibly damaging Het
Adgrv1 A G 13: 81,492,963 (GRCm38) Y3318H probably damaging Het
Akap6 A G 12: 52,911,907 (GRCm38) Y815C probably damaging Het
Ankar T A 1: 72,665,135 (GRCm38) D876V possibly damaging Het
Atp6v1g2 G A 17: 35,237,757 (GRCm38) V106I probably benign Het
Bdp1 A G 13: 100,077,862 (GRCm38) S490P probably benign Het
Bet1 A T 6: 4,077,918 (GRCm38) V107D probably damaging Het
Bri3bp T C 5: 125,454,326 (GRCm38) V112A probably damaging Het
Cage1 T A 13: 38,032,375 (GRCm38) D33V probably damaging Het
Ccdc146 G T 5: 21,330,579 (GRCm38) A159E probably damaging Het
Ccnl1 C A 3: 65,957,983 (GRCm38) G49V probably damaging Het
Cdk13 A C 13: 17,751,855 (GRCm38) F787V Het
Cdk5r1 T C 11: 80,477,654 (GRCm38) V49A probably benign Het
Cdon G A 9: 35,486,905 (GRCm38) V973I probably damaging Het
Cfap298 A T 16: 90,927,387 (GRCm38) M166K probably benign Het
Chd1l T A 3: 97,581,147 (GRCm38) K518* probably null Het
Col24a1 A G 3: 145,545,205 (GRCm38) D1653G probably benign Het
Cstf3 G T 2: 104,653,025 (GRCm38) V359F possibly damaging Het
Dchs2 T C 3: 83,270,886 (GRCm38) I1082T probably damaging Het
Dlec1 A T 9: 119,127,465 (GRCm38) I736F probably damaging Het
Dnah9 T C 11: 65,927,649 (GRCm38) N3288D probably benign Het
Ehbp1 T C 11: 22,169,124 (GRCm38) D182G probably damaging Het
Eif1ad13 A G 12: 87,795,737 (GRCm38) I76V probably benign Het
Evc2 G T 5: 37,386,786 (GRCm38) E626D probably benign Het
Evi5 T C 5: 107,795,712 (GRCm38) E589G probably benign Het
Exoc4 T C 6: 33,249,226 (GRCm38) I25T probably benign Het
Extl2 T A 3: 116,027,496 (GRCm38) *331R probably null Het
Fkbp8 G A 8: 70,531,674 (GRCm38) R225H probably damaging Het
Foxred2 A T 15: 77,952,006 (GRCm38) S384T probably damaging Het
Garre1 A T 7: 34,248,231 (GRCm38) C451S probably damaging Het
Glmn T C 5: 107,593,865 (GRCm38) E18G probably damaging Het
Gm17018 G T 19: 45,571,983 (GRCm38) E82* probably null Het
Gm7489 C A 15: 53,885,972 (GRCm38) Q147K unknown Het
Gm7489 A C 15: 53,885,973 (GRCm38) Q147P unknown Het
Gm8005 T A 14: 42,438,398 (GRCm38) I94F Het
Golgb1 G A 16: 36,919,605 (GRCm38) V2810M probably benign Het
Gpr21 T C 2: 37,518,387 (GRCm38) L315P probably damaging Het
Grip1 G A 10: 120,038,664 (GRCm38) E778K possibly damaging Het
Herc6 T G 6: 57,652,032 (GRCm38) S643A probably benign Het
Igkv14-100 T A 6: 68,519,333 (GRCm38) I70N probably damaging Het
Kcnn3 A G 3: 89,609,396 (GRCm38) M371V probably benign Het
Kif1a T A 1: 93,025,694 (GRCm38) H1256L probably damaging Het
Klhdc4 A G 8: 121,801,178 (GRCm38) S266P possibly damaging Het
Kmt2d CTGTTG CTG 15: 98,845,176 (GRCm38) probably benign Het
Lefty2 T A 1: 180,894,721 (GRCm38) L208Q probably damaging Het
Lingo2 T C 4: 35,708,450 (GRCm38) Y510C probably damaging Het
Lrif1 T A 3: 106,731,884 (GRCm38) V70D probably damaging Het
Lrrc74a A T 12: 86,758,571 (GRCm38) K389I possibly damaging Het
Megf8 A T 7: 25,355,063 (GRCm38) E1868V probably benign Het
Mmp1a TG TGG 9: 7,465,083 (GRCm38) probably null Het
Mmp8 A G 9: 7,560,607 (GRCm38) D95G probably damaging Het
Mmrn1 T A 6: 60,976,424 (GRCm38) I563N probably damaging Het
Mroh3 T C 1: 136,190,975 (GRCm38) T535A probably benign Het
Mroh9 A G 1: 163,038,929 (GRCm38) L715P probably damaging Het
Myh6 G T 14: 54,963,597 (GRCm38) A136E probably benign Het
Nod2 G T 8: 88,670,473 (GRCm38) C837F probably benign Het
Nos2 T A 11: 78,949,158 (GRCm38) W698R probably damaging Het
Nup210l C T 3: 90,199,866 (GRCm38) P1570L probably benign Het
Oas1a A T 5: 120,901,965 (GRCm38) S188T possibly damaging Het
Ogfr GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG 2: 180,595,266 (GRCm38) probably benign Het
Opa1 T C 16: 29,611,437 (GRCm38) M394T Het
Or1e1d-ps1 T A 11: 73,928,549 (GRCm38) D108E possibly damaging Het
Or5an6 A T 19: 12,394,619 (GRCm38) M119L probably damaging Het
Or5p66 A G 7: 108,286,280 (GRCm38) M282T probably benign Het
Or7g21 T A 9: 19,121,464 (GRCm38) S167T probably benign Het
Or7g29 A G 9: 19,375,381 (GRCm38) S167P possibly damaging Het
Oxct2a T A 4: 123,323,336 (GRCm38) D84V probably damaging Het
Oxct2b A C 4: 123,117,226 (GRCm38) D313A probably damaging Het
Phldb3 G A 7: 24,628,947 (GRCm38) V639M probably damaging Het
Plppr4 T A 3: 117,321,961 (GRCm38) N749I probably benign Het
Pmp22 G T 11: 63,133,239 (GRCm38) V25F probably benign Het
Pofut2 A T 10: 77,265,929 (GRCm38) M267L probably benign Het
Ppp1r42 T A 1: 9,968,842 (GRCm38) N351I possibly damaging Het
Prl2b1 T C 13: 27,388,496 (GRCm38) E37G probably benign Het
Ptpro G T 6: 137,414,320 (GRCm38) V813F probably benign Het
Rnaseh2c T C 19: 5,602,315 (GRCm38) F99L probably benign Het
Scn9a T A 2: 66,533,364 (GRCm38) I857F probably damaging Het
Slf1 A G 13: 77,049,085 (GRCm38) probably null Het
Smyd2 T C 1: 189,880,786 (GRCm38) *434W probably null Het
Spata31h1 T A 10: 82,289,619 (GRCm38) N2519I possibly damaging Het
Stk40 A G 4: 126,136,857 (GRCm38) D290G probably damaging Het
Tdo2 C A 3: 81,971,694 (GRCm38) W82C probably damaging Het
Tmem101 A G 11: 102,153,368 (GRCm38) V231A probably damaging Het
Tns2 G A 15: 102,107,142 (GRCm38) E160K probably damaging Het
Trim31 A T 17: 36,901,659 (GRCm38) D174V probably benign Het
Unc13d A T 11: 116,070,318 (GRCm38) Y404* probably null Het
Ush2a C A 1: 188,359,866 (GRCm38) Y531* probably null Het
Vapa G A 17: 65,582,741 (GRCm38) P144S probably benign Het
Vmn1r212 C T 13: 22,883,273 (GRCm38) V297M possibly damaging Het
Vmn2r80 A C 10: 79,194,878 (GRCm38) N846T probably damaging Het
Zfp811 A G 17: 32,798,766 (GRCm38) V100A probably benign Het
Zfp958 T A 8: 4,628,298 (GRCm38) C108S probably damaging Het
Zic5 G A 14: 122,459,688 (GRCm38) T505I unknown Het
Other mutations in Myom1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Myom1 APN 17 71,126,098 (GRCm38) missense probably damaging 1.00
IGL00845:Myom1 APN 17 71,084,429 (GRCm38) missense probably damaging 1.00
IGL00904:Myom1 APN 17 71,099,949 (GRCm38) splice site probably benign
IGL00928:Myom1 APN 17 71,089,913 (GRCm38) missense probably damaging 1.00
IGL01025:Myom1 APN 17 71,077,917 (GRCm38) missense probably damaging 1.00
IGL01548:Myom1 APN 17 71,101,220 (GRCm38) splice site probably benign
IGL01588:Myom1 APN 17 71,117,437 (GRCm38) missense possibly damaging 0.94
IGL01614:Myom1 APN 17 71,126,178 (GRCm38) missense possibly damaging 0.46
IGL01618:Myom1 APN 17 71,099,993 (GRCm38) missense possibly damaging 0.87
IGL01619:Myom1 APN 17 71,044,476 (GRCm38) splice site probably benign
IGL01766:Myom1 APN 17 71,077,288 (GRCm38) missense probably damaging 1.00
IGL02105:Myom1 APN 17 71,047,716 (GRCm38) splice site probably benign
IGL02122:Myom1 APN 17 71,092,137 (GRCm38) missense probably damaging 1.00
IGL02184:Myom1 APN 17 71,072,137 (GRCm38) missense possibly damaging 0.93
IGL02260:Myom1 APN 17 71,108,315 (GRCm38) nonsense probably null
IGL02486:Myom1 APN 17 71,099,944 (GRCm38) splice site probably benign
IGL02501:Myom1 APN 17 71,072,081 (GRCm38) critical splice acceptor site probably null
IGL02642:Myom1 APN 17 71,101,098 (GRCm38) missense possibly damaging 0.90
IGL02677:Myom1 APN 17 71,084,349 (GRCm38) missense probably damaging 1.00
IGL02719:Myom1 APN 17 71,106,354 (GRCm38) splice site probably benign
IGL02945:Myom1 APN 17 71,092,093 (GRCm38) splice site probably benign
IGL03086:Myom1 APN 17 71,108,671 (GRCm38) missense probably damaging 1.00
IGL03218:Myom1 APN 17 71,084,316 (GRCm38) missense possibly damaging 0.46
R0107:Myom1 UTSW 17 71,077,365 (GRCm38) missense probably damaging 1.00
R0130:Myom1 UTSW 17 71,045,755 (GRCm38) missense probably damaging 0.98
R0133:Myom1 UTSW 17 71,047,787 (GRCm38) missense probably damaging 1.00
R0206:Myom1 UTSW 17 71,037,297 (GRCm38) missense probably damaging 1.00
R0206:Myom1 UTSW 17 71,037,297 (GRCm38) missense probably damaging 1.00
R0352:Myom1 UTSW 17 71,045,749 (GRCm38) missense possibly damaging 0.72
R0396:Myom1 UTSW 17 71,034,693 (GRCm38) missense probably damaging 1.00
R0496:Myom1 UTSW 17 71,084,306 (GRCm38) missense probably damaging 1.00
R0506:Myom1 UTSW 17 71,092,220 (GRCm38) splice site probably benign
R0511:Myom1 UTSW 17 71,084,317 (GRCm38) missense probably benign 0.22
R0600:Myom1 UTSW 17 71,120,648 (GRCm38) missense possibly damaging 0.48
R0699:Myom1 UTSW 17 71,067,313 (GRCm38) missense probably damaging 0.98
R0791:Myom1 UTSW 17 71,121,136 (GRCm38) missense probably damaging 1.00
R0792:Myom1 UTSW 17 71,121,136 (GRCm38) missense probably damaging 1.00
R0963:Myom1 UTSW 17 71,077,767 (GRCm38) missense possibly damaging 0.74
R1324:Myom1 UTSW 17 71,052,719 (GRCm38) missense probably damaging 0.98
R2102:Myom1 UTSW 17 71,101,029 (GRCm38) missense probably damaging 1.00
R2158:Myom1 UTSW 17 71,064,597 (GRCm38) missense possibly damaging 0.83
R2336:Myom1 UTSW 17 71,023,194 (GRCm38) missense possibly damaging 0.53
R2351:Myom1 UTSW 17 71,034,579 (GRCm38) missense probably damaging 0.98
R2442:Myom1 UTSW 17 71,110,735 (GRCm38) missense probably damaging 1.00
R2483:Myom1 UTSW 17 71,077,812 (GRCm38) missense probably damaging 1.00
R2892:Myom1 UTSW 17 71,034,653 (GRCm38) missense probably damaging 1.00
R2897:Myom1 UTSW 17 71,101,220 (GRCm38) splice site probably benign
R3440:Myom1 UTSW 17 71,045,663 (GRCm38) splice site probably null
R3842:Myom1 UTSW 17 71,045,624 (GRCm38) missense probably damaging 1.00
R4249:Myom1 UTSW 17 71,092,140 (GRCm38) missense probably damaging 1.00
R4329:Myom1 UTSW 17 71,036,353 (GRCm38) missense probably damaging 1.00
R4594:Myom1 UTSW 17 71,100,074 (GRCm38) missense possibly damaging 0.73
R4873:Myom1 UTSW 17 71,072,119 (GRCm38) missense probably damaging 1.00
R4875:Myom1 UTSW 17 71,072,119 (GRCm38) missense probably damaging 1.00
R4876:Myom1 UTSW 17 71,077,410 (GRCm38) missense probably damaging 1.00
R5171:Myom1 UTSW 17 71,099,972 (GRCm38) missense possibly damaging 0.94
R5540:Myom1 UTSW 17 71,109,787 (GRCm38) missense probably damaging 1.00
R5882:Myom1 UTSW 17 71,110,722 (GRCm38) missense probably damaging 1.00
R5978:Myom1 UTSW 17 71,117,443 (GRCm38) missense probably damaging 1.00
R6039:Myom1 UTSW 17 71,110,751 (GRCm38) missense probably damaging 1.00
R6039:Myom1 UTSW 17 71,110,751 (GRCm38) missense probably damaging 1.00
R6155:Myom1 UTSW 17 71,108,695 (GRCm38) critical splice donor site probably null
R6261:Myom1 UTSW 17 71,126,137 (GRCm38) missense probably damaging 1.00
R6284:Myom1 UTSW 17 71,022,892 (GRCm38) nonsense probably null
R6313:Myom1 UTSW 17 71,082,488 (GRCm38) missense probably benign
R6369:Myom1 UTSW 17 71,101,076 (GRCm38) missense probably damaging 1.00
R6545:Myom1 UTSW 17 71,082,305 (GRCm38) missense probably benign 0.00
R6738:Myom1 UTSW 17 71,100,398 (GRCm38) splice site probably null
R6933:Myom1 UTSW 17 71,052,671 (GRCm38) missense probably damaging 1.00
R7168:Myom1 UTSW 17 71,089,947 (GRCm38) missense probably benign 0.00
R7286:Myom1 UTSW 17 71,045,549 (GRCm38) missense possibly damaging 0.90
R7315:Myom1 UTSW 17 71,080,897 (GRCm38) critical splice donor site probably null
R7672:Myom1 UTSW 17 71,084,240 (GRCm38) missense possibly damaging 0.92
R7789:Myom1 UTSW 17 71,117,436 (GRCm38) missense probably benign 0.03
R7898:Myom1 UTSW 17 71,045,752 (GRCm38) missense probably benign 0.25
R8008:Myom1 UTSW 17 71,100,062 (GRCm38) missense probably benign 0.30
R8152:Myom1 UTSW 17 71,084,295 (GRCm38) missense probably damaging 0.96
R8554:Myom1 UTSW 17 71,036,453 (GRCm38) missense possibly damaging 0.94
R8874:Myom1 UTSW 17 71,106,204 (GRCm38) missense probably damaging 1.00
R8981:Myom1 UTSW 17 71,084,321 (GRCm38) missense probably benign 0.09
R9012:Myom1 UTSW 17 71,100,108 (GRCm38) missense probably benign 0.06
R9090:Myom1 UTSW 17 71,067,330 (GRCm38) missense probably damaging 1.00
R9193:Myom1 UTSW 17 71,036,300 (GRCm38) missense probably damaging 1.00
R9237:Myom1 UTSW 17 71,101,056 (GRCm38) missense probably damaging 1.00
R9271:Myom1 UTSW 17 71,067,330 (GRCm38) missense probably damaging 1.00
R9355:Myom1 UTSW 17 71,077,893 (GRCm38) missense probably damaging 1.00
R9362:Myom1 UTSW 17 71,036,293 (GRCm38) missense probably benign 0.00
R9440:Myom1 UTSW 17 71,126,334 (GRCm38) missense probably benign 0.00
R9469:Myom1 UTSW 17 71,061,127 (GRCm38) missense possibly damaging 0.79
R9568:Myom1 UTSW 17 71,087,481 (GRCm38) missense probably damaging 1.00
R9645:Myom1 UTSW 17 71,092,209 (GRCm38) missense probably benign 0.01
X0019:Myom1 UTSW 17 71,100,071 (GRCm38) missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- ATGTCTGTCAGTCTGAGGCC -3'
(R):5'- GATGCGTACACAGAAATTGACTG -3'

Sequencing Primer
(F):5'- TTGCTATCGGTACTGACC -3'
(R):5'- CTAGGATGAGCCCCTGATAGGTTAC -3'
Posted On 2022-09-12