Incidental Mutation 'R9612:Myom1'
ID 724357
Institutional Source Beutler Lab
Gene Symbol Myom1
Ensembl Gene ENSMUSG00000024049
Gene Name myomesin 1
Synonyms skelemin, D430047A17Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9612 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 71019521-71126856 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) G to T at 71105480 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 1231 (E1231*)
Ref Sequence ENSEMBL: ENSMUSP00000072945 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024847] [ENSMUST00000073211] [ENSMUST00000179759]
AlphaFold Q62234
PDB Structure Skelemin Immunoglobulin C2 like domain 4 [SOLUTION NMR]
Skelemin Association with alfa2b,betta3 Integrin: A Structural Model [SOLUTION NMR]
Predicted Effect probably null
Transcript: ENSMUST00000024847
AA Change: E1133*
SMART Domains Protein: ENSMUSP00000024847
Gene: ENSMUSG00000024049
AA Change: E1133*

DomainStartEndE-ValueType
low complexity region 62 94 N/A INTRINSIC
low complexity region 188 210 N/A INTRINSIC
low complexity region 228 244 N/A INTRINSIC
IG 264 351 1.16e-8 SMART
IG 397 480 5.84e-5 SMART
FN3 490 573 4.48e-13 SMART
FN3 618 701 1.61e-14 SMART
FN3 719 800 1.43e-11 SMART
FN3 818 904 4.99e-11 SMART
FN3 923 1008 2.04e-16 SMART
IG 1025 1110 3.1e0 SMART
IG_like 1133 1219 1.34e1 SMART
IG_like 1253 1319 4.79e0 SMART
IG_like 1356 1433 1.54e2 SMART
IGc2 1469 1537 2.05e-9 SMART
Predicted Effect probably null
Transcript: ENSMUST00000073211
AA Change: E1231*
SMART Domains Protein: ENSMUSP00000072945
Gene: ENSMUSG00000024049
AA Change: E1231*

DomainStartEndE-ValueType
low complexity region 62 94 N/A INTRINSIC
low complexity region 188 210 N/A INTRINSIC
low complexity region 228 244 N/A INTRINSIC
IG 264 351 1.16e-8 SMART
IG 397 480 5.84e-5 SMART
FN3 490 573 4.48e-13 SMART
FN3 618 701 1.61e-14 SMART
FN3 719 800 1.43e-11 SMART
low complexity region 857 870 N/A INTRINSIC
FN3 916 1002 4.99e-11 SMART
FN3 1021 1106 2.04e-16 SMART
IG 1123 1208 3.1e0 SMART
IG_like 1231 1317 1.34e1 SMART
IG_like 1351 1417 4.79e0 SMART
IG_like 1454 1531 1.54e2 SMART
IGc2 1567 1635 2.05e-9 SMART
Predicted Effect probably null
Transcript: ENSMUST00000179759
AA Change: E1133*
SMART Domains Protein: ENSMUSP00000136266
Gene: ENSMUSG00000024049
AA Change: E1133*

DomainStartEndE-ValueType
low complexity region 62 94 N/A INTRINSIC
low complexity region 188 210 N/A INTRINSIC
low complexity region 228 244 N/A INTRINSIC
IG 264 351 1.16e-8 SMART
IG 397 480 5.84e-5 SMART
FN3 490 573 4.48e-13 SMART
FN3 618 701 1.61e-14 SMART
FN3 719 800 1.43e-11 SMART
FN3 818 904 4.99e-11 SMART
FN3 923 1008 2.04e-16 SMART
IG 1025 1110 3.1e0 SMART
IG_like 1133 1219 1.34e1 SMART
IG_like 1253 1319 4.79e0 SMART
IG_like 1356 1433 1.54e2 SMART
IGc2 1469 1537 2.05e-9 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The giant protein titin, together with its associated proteins, interconnects the major structure of sarcomeres, the M bands and Z discs. The C-terminal end of the titin string extends into the M line, where it binds tightly to M-band constituents of apparent molecular masses of 190 kD (myomesin 1) and 165 kD (myomesin 2). This protein, myomesin 1, like myomesin 2, titin, and other myofibrillar proteins contains structural modules with strong homology to either fibronectin type III (motif I) or immunoglobulin C2 (motif II) domains. Myomesin 1 and myomesin 2 each have a unique N-terminal region followed by 12 modules of motif I or motif II, in the arrangement II-II-I-I-I-I-I-II-II-II-II-II. The two proteins share 50% sequence identity in this repeat-containing region. The head structure formed by these 2 proteins on one end of the titin string extends into the center of the M band. The integrating structure of the sarcomere arises from muscle-specific members of the superfamily of immunoglobulin-like proteins. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110004E09Rik A T 16: 90,927,387 M166K probably benign Het
2610021A01Rik T C 7: 41,626,903 S677P possibly damaging Het
4931406P16Rik A T 7: 34,248,231 C451S probably damaging Het
4932415D10Rik T A 10: 82,289,619 N2519I possibly damaging Het
5730480H06Rik A G 5: 48,374,530 I67V probably benign Het
Adam15 T A 3: 89,341,940 Y736F probably damaging Het
Adam29 A T 8: 55,872,083 F445L possibly damaging Het
Adgrv1 A G 13: 81,492,963 Y3318H probably damaging Het
Akap6 A G 12: 52,911,907 Y815C probably damaging Het
Ankar T A 1: 72,665,135 D876V possibly damaging Het
Atp6v1g2 G A 17: 35,237,757 V106I probably benign Het
Bdp1 A G 13: 100,077,862 S490P probably benign Het
Bet1 A T 6: 4,077,918 V107D probably damaging Het
Bri3bp T C 5: 125,454,326 V112A probably damaging Het
Cage1 T A 13: 38,032,375 D33V probably damaging Het
Ccdc146 G T 5: 21,330,579 A159E probably damaging Het
Ccnl1 C A 3: 65,957,983 G49V probably damaging Het
Cdk13 A C 13: 17,751,855 F787V Het
Cdk5r1 T C 11: 80,477,654 V49A probably benign Het
Cdon G A 9: 35,486,905 V973I probably damaging Het
Chd1l T A 3: 97,581,147 K518* probably null Het
Col24a1 A G 3: 145,545,205 D1653G probably benign Het
Cstf3 G T 2: 104,653,025 V359F possibly damaging Het
Dchs2 T C 3: 83,270,886 I1082T probably damaging Het
Dlec1 A T 9: 119,127,465 I736F probably damaging Het
Dnah9 T C 11: 65,927,649 N3288D probably benign Het
Ehbp1 T C 11: 22,169,124 D182G probably damaging Het
Evc2 G T 5: 37,386,786 E626D probably benign Het
Evi5 T C 5: 107,795,712 E589G probably benign Het
Exoc4 T C 6: 33,249,226 I25T probably benign Het
Extl2 T A 3: 116,027,496 *331R probably null Het
Fkbp8 G A 8: 70,531,674 R225H probably damaging Het
Foxred2 A T 15: 77,952,006 S384T probably damaging Het
Glmn T C 5: 107,593,865 E18G probably damaging Het
Gm17018 G T 19: 45,571,983 E82* probably null Het
Gm21936 A G 12: 87,795,737 I76V probably benign Het
Gm7489 C A 15: 53,885,972 Q147K unknown Het
Gm7489 A C 15: 53,885,973 Q147P unknown Het
Gm8005 T A 14: 42,438,398 I94F Het
Golgb1 G A 16: 36,919,605 V2810M probably benign Het
Gpr21 T C 2: 37,518,387 L315P probably damaging Het
Grip1 G A 10: 120,038,664 E778K possibly damaging Het
Herc6 T G 6: 57,652,032 S643A probably benign Het
Igkv14-100 T A 6: 68,519,333 I70N probably damaging Het
Kcnn3 A G 3: 89,609,396 M371V probably benign Het
Kif1a T A 1: 93,025,694 H1256L probably damaging Het
Klhdc4 A G 8: 121,801,178 S266P possibly damaging Het
Kmt2d CTGTTG CTG 15: 98,845,176 probably benign Het
Lefty2 T A 1: 180,894,721 L208Q probably damaging Het
Lingo2 T C 4: 35,708,450 Y510C probably damaging Het
Lrif1 T A 3: 106,731,884 V70D probably damaging Het
Lrrc74a A T 12: 86,758,571 K389I possibly damaging Het
Megf8 A T 7: 25,355,063 E1868V probably benign Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Mmp8 A G 9: 7,560,607 D95G probably damaging Het
Mmrn1 T A 6: 60,976,424 I563N probably damaging Het
Mroh3 T C 1: 136,190,975 T535A probably benign Het
Mroh9 A G 1: 163,038,929 L715P probably damaging Het
Myh6 G T 14: 54,963,597 A136E probably benign Het
Nod2 G T 8: 88,670,473 C837F probably benign Het
Nos2 T A 11: 78,949,158 W698R probably damaging Het
Nup210l C T 3: 90,199,866 P1570L probably benign Het
Oas1a A T 5: 120,901,965 S188T possibly damaging Het
Ogfr GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG 2: 180,595,266 probably benign Het
Olfr1440 A T 19: 12,394,619 M119L probably damaging Het
Olfr396-ps1 T A 11: 73,928,549 D108E possibly damaging Het
Olfr490 A G 7: 108,286,280 M282T probably benign Het
Olfr836 T A 9: 19,121,464 S167T probably benign Het
Olfr847 A G 9: 19,375,381 S167P possibly damaging Het
Opa1 T C 16: 29,611,437 M394T Het
Oxct2a T A 4: 123,323,336 D84V probably damaging Het
Oxct2b A C 4: 123,117,226 D313A probably damaging Het
Phldb3 G A 7: 24,628,947 V639M probably damaging Het
Plppr4 T A 3: 117,321,961 N749I probably benign Het
Pmp22 G T 11: 63,133,239 V25F probably benign Het
Pofut2 A T 10: 77,265,929 M267L probably benign Het
Ppp1r42 T A 1: 9,968,842 N351I possibly damaging Het
Prl2b1 T C 13: 27,388,496 E37G probably benign Het
Ptpro G T 6: 137,414,320 V813F probably benign Het
Rnaseh2c T C 19: 5,602,315 F99L probably benign Het
Scn9a T A 2: 66,533,364 I857F probably damaging Het
Slf1 A G 13: 77,049,085 probably null Het
Smyd2 T C 1: 189,880,786 *434W probably null Het
Stk40 A G 4: 126,136,857 D290G probably damaging Het
Tdo2 C A 3: 81,971,694 W82C probably damaging Het
Tmem101 A G 11: 102,153,368 V231A probably damaging Het
Tns2 G A 15: 102,107,142 E160K probably damaging Het
Trim31 A T 17: 36,901,659 D174V probably benign Het
Unc13d A T 11: 116,070,318 Y404* probably null Het
Ush2a C A 1: 188,359,866 Y531* probably null Het
Vapa G A 17: 65,582,741 P144S probably benign Het
Vmn1r212 C T 13: 22,883,273 V297M possibly damaging Het
Vmn2r80 A C 10: 79,194,878 N846T probably damaging Het
Zfp811 A G 17: 32,798,766 V100A probably benign Het
Zfp958 T A 8: 4,628,298 C108S probably damaging Het
Zic5 G A 14: 122,459,688 T505I unknown Het
Other mutations in Myom1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Myom1 APN 17 71126098 missense probably damaging 1.00
IGL00845:Myom1 APN 17 71084429 missense probably damaging 1.00
IGL00904:Myom1 APN 17 71099949 splice site probably benign
IGL00928:Myom1 APN 17 71089913 missense probably damaging 1.00
IGL01025:Myom1 APN 17 71077917 missense probably damaging 1.00
IGL01548:Myom1 APN 17 71101220 splice site probably benign
IGL01588:Myom1 APN 17 71117437 missense possibly damaging 0.94
IGL01614:Myom1 APN 17 71126178 missense possibly damaging 0.46
IGL01618:Myom1 APN 17 71099993 missense possibly damaging 0.87
IGL01619:Myom1 APN 17 71044476 splice site probably benign
IGL01766:Myom1 APN 17 71077288 missense probably damaging 1.00
IGL02105:Myom1 APN 17 71047716 splice site probably benign
IGL02122:Myom1 APN 17 71092137 missense probably damaging 1.00
IGL02184:Myom1 APN 17 71072137 missense possibly damaging 0.93
IGL02260:Myom1 APN 17 71108315 nonsense probably null
IGL02486:Myom1 APN 17 71099944 splice site probably benign
IGL02501:Myom1 APN 17 71072081 critical splice acceptor site probably null
IGL02642:Myom1 APN 17 71101098 missense possibly damaging 0.90
IGL02677:Myom1 APN 17 71084349 missense probably damaging 1.00
IGL02719:Myom1 APN 17 71106354 splice site probably benign
IGL02945:Myom1 APN 17 71092093 splice site probably benign
IGL03086:Myom1 APN 17 71108671 missense probably damaging 1.00
IGL03218:Myom1 APN 17 71084316 missense possibly damaging 0.46
R0107:Myom1 UTSW 17 71077365 missense probably damaging 1.00
R0130:Myom1 UTSW 17 71045755 missense probably damaging 0.98
R0133:Myom1 UTSW 17 71047787 missense probably damaging 1.00
R0206:Myom1 UTSW 17 71037297 missense probably damaging 1.00
R0206:Myom1 UTSW 17 71037297 missense probably damaging 1.00
R0352:Myom1 UTSW 17 71045749 missense possibly damaging 0.72
R0396:Myom1 UTSW 17 71034693 missense probably damaging 1.00
R0496:Myom1 UTSW 17 71084306 missense probably damaging 1.00
R0506:Myom1 UTSW 17 71092220 splice site probably benign
R0511:Myom1 UTSW 17 71084317 missense probably benign 0.22
R0600:Myom1 UTSW 17 71120648 missense possibly damaging 0.48
R0699:Myom1 UTSW 17 71067313 missense probably damaging 0.98
R0791:Myom1 UTSW 17 71121136 missense probably damaging 1.00
R0792:Myom1 UTSW 17 71121136 missense probably damaging 1.00
R0963:Myom1 UTSW 17 71077767 missense possibly damaging 0.74
R1324:Myom1 UTSW 17 71052719 missense probably damaging 0.98
R2102:Myom1 UTSW 17 71101029 missense probably damaging 1.00
R2158:Myom1 UTSW 17 71064597 missense possibly damaging 0.83
R2336:Myom1 UTSW 17 71023194 missense possibly damaging 0.53
R2351:Myom1 UTSW 17 71034579 missense probably damaging 0.98
R2442:Myom1 UTSW 17 71110735 missense probably damaging 1.00
R2483:Myom1 UTSW 17 71077812 missense probably damaging 1.00
R2892:Myom1 UTSW 17 71034653 missense probably damaging 1.00
R2897:Myom1 UTSW 17 71101220 splice site probably benign
R3440:Myom1 UTSW 17 71045663 splice site probably null
R3842:Myom1 UTSW 17 71045624 missense probably damaging 1.00
R4249:Myom1 UTSW 17 71092140 missense probably damaging 1.00
R4329:Myom1 UTSW 17 71036353 missense probably damaging 1.00
R4594:Myom1 UTSW 17 71100074 missense possibly damaging 0.73
R4873:Myom1 UTSW 17 71072119 missense probably damaging 1.00
R4875:Myom1 UTSW 17 71072119 missense probably damaging 1.00
R4876:Myom1 UTSW 17 71077410 missense probably damaging 1.00
R5171:Myom1 UTSW 17 71099972 missense possibly damaging 0.94
R5540:Myom1 UTSW 17 71109787 missense probably damaging 1.00
R5882:Myom1 UTSW 17 71110722 missense probably damaging 1.00
R5978:Myom1 UTSW 17 71117443 missense probably damaging 1.00
R6039:Myom1 UTSW 17 71110751 missense probably damaging 1.00
R6039:Myom1 UTSW 17 71110751 missense probably damaging 1.00
R6155:Myom1 UTSW 17 71108695 critical splice donor site probably null
R6261:Myom1 UTSW 17 71126137 missense probably damaging 1.00
R6284:Myom1 UTSW 17 71022892 nonsense probably null
R6313:Myom1 UTSW 17 71082488 missense probably benign
R6369:Myom1 UTSW 17 71101076 missense probably damaging 1.00
R6545:Myom1 UTSW 17 71082305 missense probably benign 0.00
R6738:Myom1 UTSW 17 71100398 splice site probably null
R6933:Myom1 UTSW 17 71052671 missense probably damaging 1.00
R7168:Myom1 UTSW 17 71089947 missense probably benign 0.00
R7286:Myom1 UTSW 17 71045549 missense possibly damaging 0.90
R7315:Myom1 UTSW 17 71080897 critical splice donor site probably null
R7672:Myom1 UTSW 17 71084240 missense possibly damaging 0.92
R7789:Myom1 UTSW 17 71117436 missense probably benign 0.03
R7898:Myom1 UTSW 17 71045752 missense probably benign 0.25
R8008:Myom1 UTSW 17 71100062 missense probably benign 0.30
R8152:Myom1 UTSW 17 71084295 missense probably damaging 0.96
R8554:Myom1 UTSW 17 71036453 missense possibly damaging 0.94
R8874:Myom1 UTSW 17 71106204 missense probably damaging 1.00
R8981:Myom1 UTSW 17 71084321 missense probably benign 0.09
R9012:Myom1 UTSW 17 71100108 missense probably benign 0.06
R9090:Myom1 UTSW 17 71067330 missense probably damaging 1.00
R9193:Myom1 UTSW 17 71036300 missense probably damaging 1.00
R9237:Myom1 UTSW 17 71101056 missense probably damaging 1.00
R9271:Myom1 UTSW 17 71067330 missense probably damaging 1.00
R9355:Myom1 UTSW 17 71077893 missense probably damaging 1.00
R9362:Myom1 UTSW 17 71036293 missense probably benign 0.00
R9440:Myom1 UTSW 17 71126334 missense probably benign 0.00
R9469:Myom1 UTSW 17 71061127 missense possibly damaging 0.79
R9568:Myom1 UTSW 17 71087481 missense probably damaging 1.00
R9645:Myom1 UTSW 17 71092209 missense probably benign 0.01
X0019:Myom1 UTSW 17 71100071 missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- ATGTCTGTCAGTCTGAGGCC -3'
(R):5'- GATGCGTACACAGAAATTGACTG -3'

Sequencing Primer
(F):5'- TTGCTATCGGTACTGACC -3'
(R):5'- CTAGGATGAGCCCCTGATAGGTTAC -3'
Posted On 2022-09-12