Incidental Mutation 'R9613:Baz2b'
ID 724364
Institutional Source Beutler Lab
Gene Symbol Baz2b
Ensembl Gene ENSMUSG00000026987
Gene Name bromodomain adjacent to zinc finger domain, 2B
Synonyms D2Ertd794e, 5830435C13Rik
MMRRC Submission
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.287) question?
Stock # R9613 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 59729707-60040183 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 59731824 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 2071 (N2071K)
Ref Sequence ENSEMBL: ENSMUSP00000088443 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090925] [ENSMUST00000112550]
AlphaFold A2AUY4
Predicted Effect probably benign
Transcript: ENSMUST00000090925
AA Change: N2071K

PolyPhen 2 Score 0.091 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000088443
Gene: ENSMUSG00000026987
AA Change: N2071K

DomainStartEndE-ValueType
low complexity region 7 46 N/A INTRINSIC
low complexity region 82 97 N/A INTRINSIC
low complexity region 147 162 N/A INTRINSIC
low complexity region 193 244 N/A INTRINSIC
low complexity region 291 308 N/A INTRINSIC
low complexity region 366 385 N/A INTRINSIC
low complexity region 528 540 N/A INTRINSIC
low complexity region 554 614 N/A INTRINSIC
low complexity region 628 637 N/A INTRINSIC
low complexity region 671 685 N/A INTRINSIC
Pfam:MBD 690 742 1e-12 PFAM
low complexity region 759 774 N/A INTRINSIC
coiled coil region 814 975 N/A INTRINSIC
DDT 1004 1069 1.19e-20 SMART
low complexity region 1199 1212 N/A INTRINSIC
low complexity region 1213 1247 N/A INTRINSIC
coiled coil region 1251 1286 N/A INTRINSIC
low complexity region 1320 1337 N/A INTRINSIC
low complexity region 1503 1524 N/A INTRINSIC
low complexity region 1569 1582 N/A INTRINSIC
low complexity region 1585 1605 N/A INTRINSIC
Blast:BROMO 1802 1843 7e-18 BLAST
PHD 1888 1934 1.71e-12 SMART
low complexity region 1942 1964 N/A INTRINSIC
low complexity region 1968 1980 N/A INTRINSIC
BROMO 2013 2121 3.85e-41 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112550
AA Change: N2071K

PolyPhen 2 Score 0.091 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000108169
Gene: ENSMUSG00000026987
AA Change: N2071K

DomainStartEndE-ValueType
low complexity region 7 46 N/A INTRINSIC
low complexity region 82 97 N/A INTRINSIC
low complexity region 147 162 N/A INTRINSIC
low complexity region 193 244 N/A INTRINSIC
low complexity region 291 308 N/A INTRINSIC
low complexity region 366 385 N/A INTRINSIC
low complexity region 528 540 N/A INTRINSIC
low complexity region 554 614 N/A INTRINSIC
low complexity region 628 637 N/A INTRINSIC
low complexity region 671 685 N/A INTRINSIC
Pfam:MBD 690 741 3.4e-13 PFAM
low complexity region 759 774 N/A INTRINSIC
coiled coil region 814 975 N/A INTRINSIC
DDT 1004 1069 1.19e-20 SMART
low complexity region 1199 1212 N/A INTRINSIC
low complexity region 1213 1247 N/A INTRINSIC
coiled coil region 1251 1286 N/A INTRINSIC
low complexity region 1320 1337 N/A INTRINSIC
low complexity region 1503 1524 N/A INTRINSIC
low complexity region 1569 1582 N/A INTRINSIC
low complexity region 1585 1605 N/A INTRINSIC
Pfam:WHIM3 1638 1676 5.1e-14 PFAM
Blast:BROMO 1802 1843 7e-18 BLAST
PHD 1888 1934 1.71e-12 SMART
low complexity region 1942 1964 N/A INTRINSIC
low complexity region 1968 1980 N/A INTRINSIC
BROMO 2013 2121 3.85e-41 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130637
SMART Domains Protein: ENSMUSP00000119690
Gene: ENSMUSG00000026987

DomainStartEndE-ValueType
Pfam:WHIM3 2 37 1.8e-13 PFAM
low complexity region 162 173 N/A INTRINSIC
PHD 214 253 2.05e-1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the bromodomain gene family. Members of this gene family encode proteins that are integral components of chromatin remodeling complexes. The encoded protein showed strong preference for the activating H3K14Ac mark in a histone peptide screen, suggesting a potential role in transcriptional activation. This gene may be associated with susceptibility to sudden cardiac death (SCD). [provided by RefSeq, Aug 2016]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik G A 3: 137,771,126 (GRCm39) R105H probably damaging Het
Chd9 C A 8: 91,683,150 (GRCm39) S530* probably null Het
Col6a6 G A 9: 105,616,401 (GRCm39) H1558Y probably benign Het
Cyp7a1 A G 4: 6,272,587 (GRCm39) F209L probably damaging Het
D430041D05Rik A G 2: 104,060,737 (GRCm39) Y702H probably benign Het
Ddx46 T A 13: 55,787,749 (GRCm39) probably null Het
Dgat2 C G 7: 98,831,692 (GRCm39) G10R probably benign Het
Dync2h1 T A 9: 7,075,769 (GRCm39) M3033L probably damaging Het
Eef1g A G 19: 8,955,018 (GRCm39) N367S probably benign Het
Eef2kmt T G 16: 5,067,272 (GRCm39) E94A possibly damaging Het
Ermp1 C A 19: 29,617,256 (GRCm39) probably null Het
Ewsr1 A C 11: 5,028,924 (GRCm39) D346E unknown Het
Fam227a G A 15: 79,518,284 (GRCm39) T340M probably benign Het
Fxr1 G A 3: 34,100,352 (GRCm39) V104I probably benign Het
Gm6176 A G 7: 21,750,529 (GRCm39) V134A possibly damaging Het
Igdcc4 G A 9: 65,027,522 (GRCm39) V195I possibly damaging Het
Ighv2-5 A G 12: 113,649,189 (GRCm39) I88T Het
Irf8 A T 8: 121,481,207 (GRCm39) T355S probably benign Het
Kif20b T A 19: 34,919,934 (GRCm39) S751T possibly damaging Het
Kitl A G 10: 99,916,781 (GRCm39) N195D probably damaging Het
Kmt2d CTGTTG CTG 15: 98,743,057 (GRCm39) probably benign Het
Macf1 A G 4: 123,420,288 (GRCm39) F322S probably benign Het
Map6 T C 7: 98,918,384 (GRCm39) S386P possibly damaging Het
Nup214 A G 2: 31,901,035 (GRCm39) D906G possibly damaging Het
Oacyl A C 18: 65,864,524 (GRCm39) T356P probably damaging Het
Or1e28-ps1 A T 11: 73,615,639 (GRCm39) D70E probably damaging Het
Or2at1 A G 7: 99,416,536 (GRCm39) T56A probably benign Het
Plekha1 C A 7: 130,479,488 (GRCm39) P2H probably damaging Het
Plekhg4 T A 8: 106,107,620 (GRCm39) D1050E probably damaging Het
Plxnb2 T C 15: 89,048,496 (GRCm39) T638A probably benign Het
Pole4 T C 6: 82,629,099 (GRCm39) Q89R probably benign Het
Prg4 T C 1: 150,331,660 (GRCm39) T338A unknown Het
Prpf3 G A 3: 95,758,931 (GRCm39) R74* probably null Het
Prss44 C A 9: 110,643,806 (GRCm39) A150E probably damaging Het
Prss51 T A 14: 64,332,461 (GRCm39) V2E possibly damaging Het
Ptpn12 A G 5: 21,203,621 (GRCm39) Y386H probably damaging Het
Septin4 A T 11: 87,469,823 (GRCm39) H3L possibly damaging Het
Spata16 G A 3: 26,932,814 (GRCm39) V347M probably damaging Het
Spata31f1e A G 4: 42,792,992 (GRCm39) V380A probably benign Het
Spinkl T A 18: 44,301,212 (GRCm39) Y42F probably damaging Het
Suds3 A T 5: 117,243,234 (GRCm39) M168K possibly damaging Het
Tdrd6 A G 17: 43,939,518 (GRCm39) I510T probably damaging Het
Tnfrsf22 T C 7: 143,198,583 (GRCm39) H44R probably benign Het
Trh G A 6: 92,219,840 (GRCm39) R159* probably null Het
Ubr4 C A 4: 139,149,073 (GRCm39) S457R Het
Usp54 T C 14: 20,600,438 (GRCm39) Y1433C probably damaging Het
Vmn1r120 G A 7: 20,787,046 (GRCm39) L222F probably benign Het
Vmn2r22 T C 6: 123,615,075 (GRCm39) I172V probably damaging Het
Vmn2r84 A G 10: 130,226,591 (GRCm39) S416P probably damaging Het
Wapl T C 14: 34,453,520 (GRCm39) V855A probably benign Het
Zmynd19 A G 2: 24,848,217 (GRCm39) I177V Het
Zscan4e G A 7: 11,040,898 (GRCm39) Q325* probably null Het
Other mutations in Baz2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Baz2b APN 2 59,743,139 (GRCm39) missense probably benign 0.02
IGL00476:Baz2b APN 2 59,744,083 (GRCm39) missense probably benign 0.06
IGL00489:Baz2b APN 2 59,788,019 (GRCm39) nonsense probably null
IGL00514:Baz2b APN 2 59,792,821 (GRCm39) missense probably benign 0.11
IGL00678:Baz2b APN 2 59,836,527 (GRCm39) missense unknown
IGL01348:Baz2b APN 2 59,764,031 (GRCm39) missense possibly damaging 0.95
IGL01354:Baz2b APN 2 59,799,233 (GRCm39) missense probably benign 0.18
IGL01924:Baz2b APN 2 59,765,615 (GRCm39) missense probably damaging 1.00
IGL02125:Baz2b APN 2 59,798,984 (GRCm39) missense probably benign 0.12
IGL02314:Baz2b APN 2 59,792,571 (GRCm39) missense probably benign
IGL02370:Baz2b APN 2 59,753,933 (GRCm39) missense possibly damaging 0.77
IGL02473:Baz2b APN 2 59,790,407 (GRCm39) missense probably benign 0.40
IGL02499:Baz2b APN 2 59,731,840 (GRCm39) missense possibly damaging 0.60
IGL02609:Baz2b APN 2 59,747,713 (GRCm39) missense possibly damaging 0.77
IGL02705:Baz2b APN 2 59,778,604 (GRCm39) missense possibly damaging 0.92
IGL02711:Baz2b APN 2 59,747,849 (GRCm39) unclassified probably benign
IGL02716:Baz2b APN 2 59,792,868 (GRCm39) missense possibly damaging 0.53
IGL02724:Baz2b APN 2 59,807,718 (GRCm39) missense possibly damaging 0.70
IGL02750:Baz2b APN 2 59,799,002 (GRCm39) missense possibly damaging 0.73
IGL02869:Baz2b APN 2 59,807,872 (GRCm39) missense probably benign 0.00
IGL02886:Baz2b APN 2 59,788,087 (GRCm39) splice site probably null
IGL02892:Baz2b APN 2 59,731,080 (GRCm39) missense probably damaging 1.00
IGL03132:Baz2b APN 2 59,738,097 (GRCm39) splice site probably benign
IGL03183:Baz2b APN 2 59,733,640 (GRCm39) missense probably benign 0.10
IGL03197:Baz2b APN 2 59,731,898 (GRCm39) missense possibly damaging 0.74
R0054:Baz2b UTSW 2 59,762,510 (GRCm39) missense probably damaging 1.00
R0054:Baz2b UTSW 2 59,762,510 (GRCm39) missense probably damaging 1.00
R0122:Baz2b UTSW 2 59,743,963 (GRCm39) splice site probably null
R0136:Baz2b UTSW 2 59,732,298 (GRCm39) missense probably benign 0.22
R0144:Baz2b UTSW 2 59,737,839 (GRCm39) missense probably damaging 0.98
R0403:Baz2b UTSW 2 59,799,721 (GRCm39) missense possibly damaging 0.70
R0498:Baz2b UTSW 2 59,732,340 (GRCm39) unclassified probably benign
R0528:Baz2b UTSW 2 59,767,083 (GRCm39) missense probably damaging 1.00
R1025:Baz2b UTSW 2 59,792,826 (GRCm39) missense probably benign 0.06
R1470:Baz2b UTSW 2 59,808,890 (GRCm39) missense possibly damaging 0.53
R1470:Baz2b UTSW 2 59,808,890 (GRCm39) missense possibly damaging 0.53
R1510:Baz2b UTSW 2 59,752,553 (GRCm39) missense probably damaging 1.00
R1511:Baz2b UTSW 2 59,792,368 (GRCm39) missense probably benign 0.12
R1514:Baz2b UTSW 2 59,792,670 (GRCm39) missense probably benign 0.13
R1519:Baz2b UTSW 2 59,778,598 (GRCm39) missense possibly damaging 0.50
R1523:Baz2b UTSW 2 59,798,981 (GRCm39) missense possibly damaging 0.47
R1630:Baz2b UTSW 2 59,836,474 (GRCm39) missense unknown
R1641:Baz2b UTSW 2 59,743,234 (GRCm39) missense probably damaging 0.99
R1674:Baz2b UTSW 2 59,743,336 (GRCm39) missense possibly damaging 0.53
R1778:Baz2b UTSW 2 59,836,480 (GRCm39) missense unknown
R1826:Baz2b UTSW 2 59,799,077 (GRCm39) missense probably benign 0.12
R1835:Baz2b UTSW 2 59,732,163 (GRCm39) missense probably benign 0.02
R1954:Baz2b UTSW 2 59,799,087 (GRCm39) missense probably benign 0.12
R1981:Baz2b UTSW 2 59,754,024 (GRCm39) missense possibly damaging 0.95
R2029:Baz2b UTSW 2 59,743,067 (GRCm39) unclassified probably benign
R2567:Baz2b UTSW 2 59,744,255 (GRCm39) missense possibly damaging 0.82
R2842:Baz2b UTSW 2 59,743,348 (GRCm39) missense probably benign 0.27
R2848:Baz2b UTSW 2 59,755,010 (GRCm39) missense possibly damaging 0.64
R3809:Baz2b UTSW 2 59,799,240 (GRCm39) missense probably benign 0.12
R3935:Baz2b UTSW 2 59,743,105 (GRCm39) missense possibly damaging 0.81
R3936:Baz2b UTSW 2 59,743,105 (GRCm39) missense possibly damaging 0.81
R4072:Baz2b UTSW 2 59,742,917 (GRCm39) splice site probably null
R4182:Baz2b UTSW 2 59,928,801 (GRCm39) intron probably benign
R4255:Baz2b UTSW 2 59,750,916 (GRCm39) unclassified probably benign
R4359:Baz2b UTSW 2 59,731,957 (GRCm39) missense possibly damaging 0.87
R4716:Baz2b UTSW 2 59,799,599 (GRCm39) missense probably benign 0.06
R4743:Baz2b UTSW 2 59,744,255 (GRCm39) missense probably benign 0.01
R4772:Baz2b UTSW 2 59,788,795 (GRCm39) missense probably damaging 0.96
R4858:Baz2b UTSW 2 59,738,087 (GRCm39) missense probably benign
R4868:Baz2b UTSW 2 59,755,226 (GRCm39) missense possibly damaging 0.65
R4872:Baz2b UTSW 2 59,773,103 (GRCm39) splice site probably null
R4889:Baz2b UTSW 2 59,767,070 (GRCm39) missense probably damaging 1.00
R4890:Baz2b UTSW 2 59,756,383 (GRCm39) missense probably damaging 0.99
R4914:Baz2b UTSW 2 59,744,387 (GRCm39) missense possibly damaging 0.70
R4915:Baz2b UTSW 2 59,744,387 (GRCm39) missense possibly damaging 0.70
R4918:Baz2b UTSW 2 59,744,387 (GRCm39) missense possibly damaging 0.70
R5027:Baz2b UTSW 2 59,928,988 (GRCm39) intron probably benign
R5031:Baz2b UTSW 2 59,743,151 (GRCm39) missense probably benign 0.00
R5082:Baz2b UTSW 2 59,731,835 (GRCm39) nonsense probably null
R5133:Baz2b UTSW 2 59,792,368 (GRCm39) missense probably benign 0.12
R5276:Baz2b UTSW 2 59,792,958 (GRCm39) missense probably benign 0.40
R5279:Baz2b UTSW 2 59,762,496 (GRCm39) missense probably damaging 1.00
R5294:Baz2b UTSW 2 59,808,946 (GRCm39) missense probably benign 0.11
R5447:Baz2b UTSW 2 59,744,332 (GRCm39) missense probably damaging 0.99
R5903:Baz2b UTSW 2 59,790,233 (GRCm39) missense probably damaging 0.99
R5910:Baz2b UTSW 2 59,807,770 (GRCm39) missense possibly damaging 0.88
R6140:Baz2b UTSW 2 59,742,871 (GRCm39) missense probably damaging 0.99
R6195:Baz2b UTSW 2 59,737,855 (GRCm39) missense possibly damaging 0.89
R6199:Baz2b UTSW 2 59,809,019 (GRCm39) missense probably benign 0.00
R6208:Baz2b UTSW 2 59,755,150 (GRCm39) missense probably damaging 1.00
R6233:Baz2b UTSW 2 59,737,855 (GRCm39) missense possibly damaging 0.89
R6276:Baz2b UTSW 2 59,778,567 (GRCm39) missense probably damaging 1.00
R6324:Baz2b UTSW 2 59,737,292 (GRCm39) missense probably damaging 1.00
R6490:Baz2b UTSW 2 59,732,073 (GRCm39) missense probably damaging 1.00
R6578:Baz2b UTSW 2 59,799,623 (GRCm39) missense possibly damaging 0.47
R6720:Baz2b UTSW 2 59,755,234 (GRCm39) missense probably damaging 1.00
R6760:Baz2b UTSW 2 59,792,776 (GRCm39) missense probably benign 0.40
R6836:Baz2b UTSW 2 59,747,769 (GRCm39) missense probably damaging 1.00
R6859:Baz2b UTSW 2 59,731,874 (GRCm39) missense probably benign 0.01
R6880:Baz2b UTSW 2 59,743,283 (GRCm39) missense probably damaging 0.99
R6916:Baz2b UTSW 2 59,799,120 (GRCm39) missense probably benign
R6978:Baz2b UTSW 2 59,738,059 (GRCm39) missense possibly damaging 0.84
R7037:Baz2b UTSW 2 59,764,014 (GRCm39) critical splice donor site probably null
R7112:Baz2b UTSW 2 59,792,528 (GRCm39) missense possibly damaging 0.53
R7117:Baz2b UTSW 2 59,742,841 (GRCm39) missense
R7198:Baz2b UTSW 2 59,792,550 (GRCm39) missense probably benign 0.00
R7270:Baz2b UTSW 2 59,792,836 (GRCm39) missense possibly damaging 0.96
R7282:Baz2b UTSW 2 59,750,781 (GRCm39) missense probably benign 0.17
R7464:Baz2b UTSW 2 59,807,792 (GRCm39) missense possibly damaging 0.53
R7609:Baz2b UTSW 2 59,792,817 (GRCm39) missense probably benign 0.40
R7703:Baz2b UTSW 2 59,747,769 (GRCm39) missense probably damaging 1.00
R7850:Baz2b UTSW 2 59,767,060 (GRCm39) missense probably damaging 0.98
R7851:Baz2b UTSW 2 59,767,060 (GRCm39) missense probably damaging 0.98
R7988:Baz2b UTSW 2 59,792,485 (GRCm39) missense possibly damaging 0.53
R8079:Baz2b UTSW 2 59,731,112 (GRCm39) missense probably damaging 1.00
R8084:Baz2b UTSW 2 59,792,580 (GRCm39) missense probably benign
R8343:Baz2b UTSW 2 59,731,858 (GRCm39) missense probably damaging 1.00
R8348:Baz2b UTSW 2 59,742,137 (GRCm39) missense
R8438:Baz2b UTSW 2 59,747,828 (GRCm39) nonsense probably null
R8448:Baz2b UTSW 2 59,742,137 (GRCm39) missense
R8511:Baz2b UTSW 2 59,732,158 (GRCm39) missense probably benign
R8893:Baz2b UTSW 2 59,755,149 (GRCm39) missense probably damaging 0.96
R8947:Baz2b UTSW 2 59,778,583 (GRCm39) missense probably benign 0.06
R8998:Baz2b UTSW 2 59,799,608 (GRCm39) missense probably benign 0.02
R9241:Baz2b UTSW 2 59,743,993 (GRCm39) missense probably benign 0.01
R9245:Baz2b UTSW 2 59,743,331 (GRCm39) missense probably benign
R9577:Baz2b UTSW 2 59,809,031 (GRCm39) missense probably benign 0.06
R9581:Baz2b UTSW 2 59,799,300 (GRCm39) missense probably benign
R9601:Baz2b UTSW 2 59,731,847 (GRCm39) missense possibly damaging 0.66
R9639:Baz2b UTSW 2 59,731,828 (GRCm39) missense probably benign 0.01
X0011:Baz2b UTSW 2 59,807,705 (GRCm39) missense possibly damaging 0.53
X0053:Baz2b UTSW 2 59,731,019 (GRCm39) missense probably damaging 1.00
X0064:Baz2b UTSW 2 59,799,626 (GRCm39) missense probably benign
Z1088:Baz2b UTSW 2 59,790,359 (GRCm39) missense probably damaging 1.00
Z1177:Baz2b UTSW 2 59,807,864 (GRCm39) missense probably benign 0.01
Z1188:Baz2b UTSW 2 59,807,749 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- GGACTCTGCAGCTCCATTAC -3'
(R):5'- AGGTCTAGGTACCGATTTCCAAC -3'

Sequencing Primer
(F):5'- ATGGCCAATCATATTCCTTATGC -3'
(R):5'- GGTACCGATTTCCAACATTATGTTC -3'
Posted On 2022-09-12