Incidental Mutation 'R9613:Map6'
ID 724383
Institutional Source Beutler Lab
Gene Symbol Map6
Ensembl Gene ENSMUSG00000055407
Gene Name microtubule-associated protein 6
Synonyms F-STOP, Mtap6, 2810411E12Rik, STOP
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.135) question?
Stock # R9613 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 99267447-99337137 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 99269177 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 386 (S386P)
Ref Sequence ENSEMBL: ENSMUSP00000064787 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068973] [ENSMUST00000107100] [ENSMUST00000122101] [ENSMUST00000127492] [ENSMUST00000207883] [ENSMUST00000208605] [ENSMUST00000208924]
AlphaFold Q7TSJ2
Predicted Effect possibly damaging
Transcript: ENSMUST00000068973
AA Change: S386P

PolyPhen 2 Score 0.900 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000064787
Gene: ENSMUSG00000055407
AA Change: S386P

DomainStartEndE-ValueType
low complexity region 42 57 N/A INTRINSIC
low complexity region 93 117 N/A INTRINSIC
internal_repeat_1 191 306 6.21e-27 PROSPERO
internal_repeat_1 302 398 6.21e-27 PROSPERO
low complexity region 501 525 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000107100
AA Change: S183P

PolyPhen 2 Score 0.858 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000102717
Gene: ENSMUSG00000055407
AA Change: S183P

DomainStartEndE-ValueType
low complexity region 12 26 N/A INTRINSIC
internal_repeat_1 28 103 5.9e-29 PROSPERO
internal_repeat_1 120 195 5.9e-29 PROSPERO
Predicted Effect possibly damaging
Transcript: ENSMUST00000122101
AA Change: S386P

PolyPhen 2 Score 0.858 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000113183
Gene: ENSMUSG00000055407
AA Change: S386P

DomainStartEndE-ValueType
Pfam:STOP 1 184 1.2e-18 PFAM
internal_repeat_1 191 306 1.99e-35 PROSPERO
internal_repeat_1 302 398 1.99e-35 PROSPERO
Predicted Effect possibly damaging
Transcript: ENSMUST00000127492
AA Change: S386P

PolyPhen 2 Score 0.900 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000207883
AA Change: S386P

PolyPhen 2 Score 0.900 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000208605
AA Change: S183P

PolyPhen 2 Score 0.858 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000208924
AA Change: S183P

PolyPhen 2 Score 0.900 (Sensitivity: 0.82; Specificity: 0.94)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a microtubule-associated protein. The encoded protein is a calmodulin-binding and calmodulin-regulated protein that is involved in microtubule stabilization. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation are devoid of cold-stable microtubules, and exhibit impaired synaptic plasticity, associated with severe behavioral abnormalities that are specifically ameliorated by long-term administration of neuroleptics. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik G A 3: 138,065,365 R105H probably damaging Het
Baz2b A T 2: 59,901,480 N2071K probably benign Het
Chd9 C A 8: 90,956,522 S530* probably null Het
Col6a6 G A 9: 105,739,202 H1558Y probably benign Het
Cyp7a1 A G 4: 6,272,587 F209L probably damaging Het
D430041D05Rik A G 2: 104,230,392 Y702H probably benign Het
Ddx46 T A 13: 55,639,936 probably null Het
Dgat2 C G 7: 99,182,485 G10R probably benign Het
Dync2h1 T A 9: 7,075,769 M3033L probably damaging Het
Eef1g A G 19: 8,977,654 N367S probably benign Het
Eef2kmt T G 16: 5,249,408 E94A possibly damaging Het
Ermp1 C A 19: 29,639,856 probably null Het
Ewsr1 A C 11: 5,078,924 D346E unknown Het
Fam227a G A 15: 79,634,083 T340M probably benign Het
Fxr1 G A 3: 34,046,203 V104I probably benign Het
Gm12394 A G 4: 42,792,992 V380A probably benign Het
Gm6176 A G 7: 22,051,104 V134A possibly damaging Het
Igdcc4 G A 9: 65,120,240 V195I possibly damaging Het
Ighv2-5 A G 12: 113,685,569 I88T Het
Irf8 A T 8: 120,754,468 T355S probably benign Het
Kif20b T A 19: 34,942,534 S751T possibly damaging Het
Kitl A G 10: 100,080,919 N195D probably damaging Het
Kmt2d CTGTTG CTG 15: 98,845,176 probably benign Het
Macf1 A G 4: 123,526,495 F322S probably benign Het
Nup214 A G 2: 32,011,023 D906G possibly damaging Het
Oacyl A C 18: 65,731,453 T356P probably damaging Het
Olfr388-ps1 A T 11: 73,724,813 D70E probably damaging Het
Olfr521 A G 7: 99,767,329 T56A probably benign Het
Plekha1 C A 7: 130,877,758 P2H probably damaging Het
Plekhg4 T A 8: 105,380,988 D1050E probably damaging Het
Plxnb2 T C 15: 89,164,293 T638A probably benign Het
Pole4 T C 6: 82,652,118 Q89R probably benign Het
Prg4 T C 1: 150,455,909 T338A unknown Het
Prpf3 G A 3: 95,851,619 R74* probably null Het
Prss44 C A 9: 110,814,738 A150E probably damaging Het
Prss51 T A 14: 64,095,012 V2E possibly damaging Het
Ptpn12 A G 5: 20,998,623 Y386H probably damaging Het
Sept4 A T 11: 87,578,997 H3L possibly damaging Het
Spata16 G A 3: 26,878,665 V347M probably damaging Het
Spinkl T A 18: 44,168,145 Y42F probably damaging Het
Suds3 A T 5: 117,105,169 M168K possibly damaging Het
Tdrd6 A G 17: 43,628,627 I510T probably damaging Het
Tnfrsf22 T C 7: 143,644,846 H44R probably benign Het
Trh G A 6: 92,242,859 R159* probably null Het
Ubr4 C A 4: 139,421,762 S457R Het
Usp54 T C 14: 20,550,370 Y1433C probably damaging Het
Vmn1r120 G A 7: 21,053,121 L222F probably benign Het
Vmn2r22 T C 6: 123,638,116 I172V probably damaging Het
Vmn2r84 A G 10: 130,390,722 S416P probably damaging Het
Wapl T C 14: 34,731,563 V855A probably benign Het
Zmynd19 A G 2: 24,958,205 I177V Het
Zscan4e G A 7: 11,306,971 Q325* probably null Het
Other mutations in Map6
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0035:Map6 UTSW 7 99317608 missense probably damaging 1.00
R0035:Map6 UTSW 7 99317608 missense probably damaging 1.00
R0118:Map6 UTSW 7 99317617 missense possibly damaging 0.53
R0125:Map6 UTSW 7 99335980 splice site probably null
R0244:Map6 UTSW 7 99336836 missense probably benign 0.00
R0973:Map6 UTSW 7 99336743 missense possibly damaging 0.78
R0973:Map6 UTSW 7 99336743 missense possibly damaging 0.78
R0974:Map6 UTSW 7 99336743 missense possibly damaging 0.78
R1455:Map6 UTSW 7 99268214 missense probably damaging 1.00
R1678:Map6 UTSW 7 99268098 missense probably damaging 1.00
R1696:Map6 UTSW 7 99317457 splice site probably null
R1866:Map6 UTSW 7 99315876 missense probably damaging 1.00
R2061:Map6 UTSW 7 99317472 missense probably damaging 1.00
R3236:Map6 UTSW 7 99336824 missense probably damaging 1.00
R3625:Map6 UTSW 7 99269195 missense possibly damaging 0.60
R4044:Map6 UTSW 7 99268049 missense probably damaging 1.00
R4570:Map6 UTSW 7 99336556 missense possibly damaging 0.49
R5056:Map6 UTSW 7 99336652 missense probably benign 0.05
R5065:Map6 UTSW 7 99336710 missense probably benign 0.02
R5656:Map6 UTSW 7 99336298 missense probably damaging 1.00
R6101:Map6 UTSW 7 99268107 missense probably damaging 1.00
R6105:Map6 UTSW 7 99268107 missense probably damaging 1.00
R6302:Map6 UTSW 7 99336107 missense probably damaging 0.99
R6450:Map6 UTSW 7 99268038 missense probably damaging 1.00
R6915:Map6 UTSW 7 99268247 missense probably damaging 1.00
R7205:Map6 UTSW 7 99269050 missense probably benign 0.00
R7223:Map6 UTSW 7 99268025 missense probably damaging 1.00
R7293:Map6 UTSW 7 99336533 missense possibly damaging 0.49
R7481:Map6 UTSW 7 99269138 missense possibly damaging 0.57
R7489:Map6 UTSW 7 99268061 missense probably damaging 1.00
R7691:Map6 UTSW 7 99336292 missense possibly damaging 0.95
R7693:Map6 UTSW 7 99336292 missense possibly damaging 0.95
R7695:Map6 UTSW 7 99336292 missense possibly damaging 0.95
R8341:Map6 UTSW 7 99268440 missense possibly damaging 0.75
R8865:Map6 UTSW 7 99268985 missense probably benign 0.37
R8953:Map6 UTSW 7 99315871 missense probably damaging 1.00
R9108:Map6 UTSW 7 99336896 missense probably damaging 1.00
R9173:Map6 UTSW 7 99268728 missense probably damaging 1.00
R9654:Map6 UTSW 7 99336959 missense probably damaging 1.00
Z1176:Map6 UTSW 7 99317660 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCAGATCAGCGTGACACAC -3'
(R):5'- TCTGGAATGTGGCTGAAGAG -3'

Sequencing Primer
(F):5'- CACACGCAGGAAGGCTG -3'
(R):5'- TCTGGCCCTGGAGAAGAAGC -3'
Posted On 2022-09-12