Incidental Mutation 'R9613:Chd9'
ID 724387
Institutional Source Beutler Lab
Gene Symbol Chd9
Ensembl Gene ENSMUSG00000056608
Gene Name chromodomain helicase DNA binding protein 9
Synonyms AD013, 1810014J18Rik, 9030205D12Rik, A330063D19Rik
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9613 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 91554980-91781144 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) C to A at 91683150 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Stop codon at position 530 (S530*)
Ref Sequence ENSEMBL: ENSMUSP00000046356 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048665] [ENSMUST00000109614] [ENSMUST00000209203] [ENSMUST00000209423] [ENSMUST00000209746] [ENSMUST00000210947] [ENSMUST00000211403]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000048665
AA Change: S530*
SMART Domains Protein: ENSMUSP00000046356
Gene: ENSMUSG00000056608
AA Change: S530*

DomainStartEndE-ValueType
low complexity region 323 334 N/A INTRINSIC
low complexity region 586 605 N/A INTRINSIC
CHROMO 687 753 2.41e-10 SMART
CHROMO 770 828 4.35e-8 SMART
DEXDc 855 1056 3.8e-36 SMART
Blast:DEXDc 1149 1174 7e-6 BLAST
HELICc 1211 1295 2.86e-22 SMART
low complexity region 1462 1475 N/A INTRINSIC
Blast:DEXDc 1506 1551 3e-16 BLAST
low complexity region 2048 2067 N/A INTRINSIC
low complexity region 2127 2199 N/A INTRINSIC
BRK 2456 2505 6.77e-25 SMART
BRK 2530 2574 1.5e-17 SMART
low complexity region 2594 2608 N/A INTRINSIC
low complexity region 2609 2639 N/A INTRINSIC
low complexity region 2642 2659 N/A INTRINSIC
low complexity region 2690 2704 N/A INTRINSIC
low complexity region 2746 2771 N/A INTRINSIC
low complexity region 2802 2813 N/A INTRINSIC
low complexity region 2843 2869 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000109614
AA Change: S530*
SMART Domains Protein: ENSMUSP00000105243
Gene: ENSMUSG00000056608
AA Change: S530*

DomainStartEndE-ValueType
low complexity region 323 334 N/A INTRINSIC
low complexity region 586 605 N/A INTRINSIC
CHROMO 687 753 2.41e-10 SMART
CHROMO 770 828 4.35e-8 SMART
DEXDc 855 1056 3.8e-36 SMART
Blast:DEXDc 1149 1174 7e-6 BLAST
HELICc 1211 1295 2.86e-22 SMART
low complexity region 1462 1475 N/A INTRINSIC
Blast:DEXDc 1506 1551 3e-16 BLAST
low complexity region 2048 2067 N/A INTRINSIC
low complexity region 2127 2199 N/A INTRINSIC
BRK 2472 2521 6.77e-25 SMART
BRK 2546 2590 1.5e-17 SMART
low complexity region 2610 2624 N/A INTRINSIC
low complexity region 2625 2655 N/A INTRINSIC
low complexity region 2658 2675 N/A INTRINSIC
low complexity region 2706 2720 N/A INTRINSIC
low complexity region 2762 2787 N/A INTRINSIC
low complexity region 2818 2829 N/A INTRINSIC
low complexity region 2859 2885 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000209203
AA Change: S530*
Predicted Effect probably null
Transcript: ENSMUST00000209423
AA Change: S530*
Predicted Effect probably benign
Transcript: ENSMUST00000209746
Predicted Effect probably null
Transcript: ENSMUST00000210947
AA Change: S57*
Predicted Effect probably null
Transcript: ENSMUST00000211403
AA Change: S530*
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik G A 3: 137,771,126 (GRCm39) R105H probably damaging Het
Baz2b A T 2: 59,731,824 (GRCm39) N2071K probably benign Het
Col6a6 G A 9: 105,616,401 (GRCm39) H1558Y probably benign Het
Cyp7a1 A G 4: 6,272,587 (GRCm39) F209L probably damaging Het
D430041D05Rik A G 2: 104,060,737 (GRCm39) Y702H probably benign Het
Ddx46 T A 13: 55,787,749 (GRCm39) probably null Het
Dgat2 C G 7: 98,831,692 (GRCm39) G10R probably benign Het
Dync2h1 T A 9: 7,075,769 (GRCm39) M3033L probably damaging Het
Eef1g A G 19: 8,955,018 (GRCm39) N367S probably benign Het
Eef2kmt T G 16: 5,067,272 (GRCm39) E94A possibly damaging Het
Ermp1 C A 19: 29,617,256 (GRCm39) probably null Het
Ewsr1 A C 11: 5,028,924 (GRCm39) D346E unknown Het
Fam227a G A 15: 79,518,284 (GRCm39) T340M probably benign Het
Fxr1 G A 3: 34,100,352 (GRCm39) V104I probably benign Het
Gm6176 A G 7: 21,750,529 (GRCm39) V134A possibly damaging Het
Igdcc4 G A 9: 65,027,522 (GRCm39) V195I possibly damaging Het
Ighv2-5 A G 12: 113,649,189 (GRCm39) I88T Het
Irf8 A T 8: 121,481,207 (GRCm39) T355S probably benign Het
Kif20b T A 19: 34,919,934 (GRCm39) S751T possibly damaging Het
Kitl A G 10: 99,916,781 (GRCm39) N195D probably damaging Het
Kmt2d CTGTTG CTG 15: 98,743,057 (GRCm39) probably benign Het
Macf1 A G 4: 123,420,288 (GRCm39) F322S probably benign Het
Map6 T C 7: 98,918,384 (GRCm39) S386P possibly damaging Het
Nup214 A G 2: 31,901,035 (GRCm39) D906G possibly damaging Het
Oacyl A C 18: 65,864,524 (GRCm39) T356P probably damaging Het
Or1e28-ps1 A T 11: 73,615,639 (GRCm39) D70E probably damaging Het
Or2at1 A G 7: 99,416,536 (GRCm39) T56A probably benign Het
Plekha1 C A 7: 130,479,488 (GRCm39) P2H probably damaging Het
Plekhg4 T A 8: 106,107,620 (GRCm39) D1050E probably damaging Het
Plxnb2 T C 15: 89,048,496 (GRCm39) T638A probably benign Het
Pole4 T C 6: 82,629,099 (GRCm39) Q89R probably benign Het
Prg4 T C 1: 150,331,660 (GRCm39) T338A unknown Het
Prpf3 G A 3: 95,758,931 (GRCm39) R74* probably null Het
Prss44 C A 9: 110,643,806 (GRCm39) A150E probably damaging Het
Prss51 T A 14: 64,332,461 (GRCm39) V2E possibly damaging Het
Ptpn12 A G 5: 21,203,621 (GRCm39) Y386H probably damaging Het
Septin4 A T 11: 87,469,823 (GRCm39) H3L possibly damaging Het
Spata16 G A 3: 26,932,814 (GRCm39) V347M probably damaging Het
Spata31f1e A G 4: 42,792,992 (GRCm39) V380A probably benign Het
Spinkl T A 18: 44,301,212 (GRCm39) Y42F probably damaging Het
Suds3 A T 5: 117,243,234 (GRCm39) M168K possibly damaging Het
Tdrd6 A G 17: 43,939,518 (GRCm39) I510T probably damaging Het
Tnfrsf22 T C 7: 143,198,583 (GRCm39) H44R probably benign Het
Trh G A 6: 92,219,840 (GRCm39) R159* probably null Het
Ubr4 C A 4: 139,149,073 (GRCm39) S457R Het
Usp54 T C 14: 20,600,438 (GRCm39) Y1433C probably damaging Het
Vmn1r120 G A 7: 20,787,046 (GRCm39) L222F probably benign Het
Vmn2r22 T C 6: 123,615,075 (GRCm39) I172V probably damaging Het
Vmn2r84 A G 10: 130,226,591 (GRCm39) S416P probably damaging Het
Wapl T C 14: 34,453,520 (GRCm39) V855A probably benign Het
Zmynd19 A G 2: 24,848,217 (GRCm39) I177V Het
Zscan4e G A 7: 11,040,898 (GRCm39) Q325* probably null Het
Other mutations in Chd9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Chd9 APN 8 91,752,020 (GRCm39) missense possibly damaging 0.79
IGL00547:Chd9 APN 8 91,732,426 (GRCm39) missense probably damaging 1.00
IGL00589:Chd9 APN 8 91,742,474 (GRCm39) missense probably damaging 1.00
IGL00640:Chd9 APN 8 91,712,760 (GRCm39) missense probably damaging 0.99
IGL00663:Chd9 APN 8 91,710,118 (GRCm39) missense probably damaging 1.00
IGL00852:Chd9 APN 8 91,699,835 (GRCm39) missense probably benign 0.29
IGL00908:Chd9 APN 8 91,723,508 (GRCm39) missense probably damaging 1.00
IGL00911:Chd9 APN 8 91,778,320 (GRCm39) missense probably damaging 1.00
IGL01068:Chd9 APN 8 91,768,744 (GRCm39) missense probably benign 0.13
IGL01668:Chd9 APN 8 91,753,404 (GRCm39) missense possibly damaging 0.53
IGL01873:Chd9 APN 8 91,660,395 (GRCm39) missense probably benign 0.00
IGL01969:Chd9 APN 8 91,760,138 (GRCm39) missense possibly damaging 0.72
IGL02105:Chd9 APN 8 91,659,116 (GRCm39) missense probably damaging 1.00
IGL02153:Chd9 APN 8 91,683,122 (GRCm39) nonsense probably null
IGL02164:Chd9 APN 8 91,659,849 (GRCm39) missense possibly damaging 0.94
IGL02725:Chd9 APN 8 91,778,312 (GRCm39) missense possibly damaging 0.78
IGL02755:Chd9 APN 8 91,760,210 (GRCm39) missense probably benign 0.33
IGL02892:Chd9 APN 8 91,703,543 (GRCm39) splice site probably benign
IGL02897:Chd9 APN 8 91,660,496 (GRCm39) splice site probably benign
IGL03005:Chd9 APN 8 91,738,075 (GRCm39) missense probably damaging 0.98
IGL03062:Chd9 APN 8 91,741,895 (GRCm39) splice site probably benign
IGL03140:Chd9 APN 8 91,768,856 (GRCm39) missense possibly damaging 0.91
hovel UTSW 8 91,741,832 (GRCm39) missense probably benign 0.19
shack UTSW 8 91,659,426 (GRCm39) missense probably damaging 1.00
R0056:Chd9 UTSW 8 91,660,165 (GRCm39) missense possibly damaging 0.62
R0157:Chd9 UTSW 8 91,735,464 (GRCm39) splice site probably null
R0238:Chd9 UTSW 8 91,659,456 (GRCm39) missense probably damaging 1.00
R0238:Chd9 UTSW 8 91,659,456 (GRCm39) missense probably damaging 1.00
R0432:Chd9 UTSW 8 91,721,078 (GRCm39) splice site probably benign
R0454:Chd9 UTSW 8 91,699,859 (GRCm39) missense possibly damaging 0.83
R0573:Chd9 UTSW 8 91,725,223 (GRCm39) missense probably damaging 1.00
R0580:Chd9 UTSW 8 91,721,191 (GRCm39) missense possibly damaging 0.91
R0604:Chd9 UTSW 8 91,763,170 (GRCm39) missense possibly damaging 0.82
R0662:Chd9 UTSW 8 91,704,304 (GRCm39) missense probably damaging 0.99
R0825:Chd9 UTSW 8 91,777,825 (GRCm39) missense probably benign 0.06
R0945:Chd9 UTSW 8 91,659,630 (GRCm39) missense possibly damaging 0.60
R0964:Chd9 UTSW 8 91,741,832 (GRCm39) missense probably benign 0.19
R0967:Chd9 UTSW 8 91,716,107 (GRCm39) missense probably damaging 1.00
R1015:Chd9 UTSW 8 91,659,206 (GRCm39) missense probably damaging 0.99
R1066:Chd9 UTSW 8 91,712,764 (GRCm39) nonsense probably null
R1244:Chd9 UTSW 8 91,749,557 (GRCm39) missense probably damaging 0.99
R1505:Chd9 UTSW 8 91,733,123 (GRCm39) splice site probably null
R1570:Chd9 UTSW 8 91,763,170 (GRCm39) missense probably benign 0.03
R1591:Chd9 UTSW 8 91,710,166 (GRCm39) missense probably damaging 0.97
R1624:Chd9 UTSW 8 91,725,163 (GRCm39) missense probably benign 0.17
R1626:Chd9 UTSW 8 91,721,224 (GRCm39) missense probably benign 0.00
R1632:Chd9 UTSW 8 91,683,335 (GRCm39) nonsense probably null
R1649:Chd9 UTSW 8 91,659,229 (GRCm39) missense possibly damaging 0.88
R1664:Chd9 UTSW 8 91,749,418 (GRCm39) splice site probably null
R1668:Chd9 UTSW 8 91,767,814 (GRCm39) missense probably damaging 0.99
R1681:Chd9 UTSW 8 91,699,763 (GRCm39) missense probably damaging 0.98
R1695:Chd9 UTSW 8 91,728,410 (GRCm39) missense probably damaging 1.00
R1714:Chd9 UTSW 8 91,760,853 (GRCm39) utr 3 prime probably benign
R1746:Chd9 UTSW 8 91,737,326 (GRCm39) missense probably benign 0.01
R1843:Chd9 UTSW 8 91,737,422 (GRCm39) missense probably benign 0.19
R1844:Chd9 UTSW 8 91,683,323 (GRCm39) nonsense probably null
R1941:Chd9 UTSW 8 91,703,697 (GRCm39) critical splice donor site probably null
R2022:Chd9 UTSW 8 91,761,682 (GRCm39) missense probably benign 0.17
R2027:Chd9 UTSW 8 91,634,619 (GRCm39) unclassified probably benign
R2098:Chd9 UTSW 8 91,760,615 (GRCm39) missense probably benign 0.01
R2099:Chd9 UTSW 8 91,760,615 (GRCm39) missense probably benign 0.01
R2100:Chd9 UTSW 8 91,760,615 (GRCm39) missense probably benign 0.01
R2101:Chd9 UTSW 8 91,760,615 (GRCm39) missense probably benign 0.01
R2224:Chd9 UTSW 8 91,737,913 (GRCm39) missense probably benign 0.04
R2276:Chd9 UTSW 8 91,760,615 (GRCm39) missense probably benign 0.01
R2278:Chd9 UTSW 8 91,760,615 (GRCm39) missense probably benign 0.01
R2316:Chd9 UTSW 8 91,777,756 (GRCm39) missense probably damaging 0.99
R2507:Chd9 UTSW 8 91,760,615 (GRCm39) missense probably benign 0.01
R2508:Chd9 UTSW 8 91,760,615 (GRCm39) missense probably benign 0.01
R2988:Chd9 UTSW 8 91,757,088 (GRCm39) splice site probably null
R3418:Chd9 UTSW 8 91,763,219 (GRCm39) missense probably damaging 1.00
R3817:Chd9 UTSW 8 91,710,893 (GRCm39) splice site probably benign
R3923:Chd9 UTSW 8 91,660,147 (GRCm39) missense probably benign 0.16
R4001:Chd9 UTSW 8 91,683,185 (GRCm39) missense probably damaging 1.00
R4003:Chd9 UTSW 8 91,683,185 (GRCm39) missense probably damaging 1.00
R4006:Chd9 UTSW 8 91,660,188 (GRCm39) missense probably benign 0.12
R4013:Chd9 UTSW 8 91,699,797 (GRCm39) missense possibly damaging 0.82
R4067:Chd9 UTSW 8 91,750,202 (GRCm39) missense possibly damaging 0.53
R4108:Chd9 UTSW 8 91,737,304 (GRCm39) missense probably benign 0.04
R4125:Chd9 UTSW 8 91,777,912 (GRCm39) missense probably damaging 0.99
R4126:Chd9 UTSW 8 91,777,912 (GRCm39) missense probably damaging 0.99
R4452:Chd9 UTSW 8 91,704,308 (GRCm39) missense probably damaging 0.99
R4463:Chd9 UTSW 8 91,705,627 (GRCm39) missense probably benign 0.01
R4478:Chd9 UTSW 8 91,760,659 (GRCm39) utr 3 prime probably benign
R4587:Chd9 UTSW 8 91,763,134 (GRCm39) missense possibly damaging 0.95
R4628:Chd9 UTSW 8 91,710,091 (GRCm39) missense probably benign 0.05
R4667:Chd9 UTSW 8 91,760,428 (GRCm39) missense possibly damaging 0.73
R4908:Chd9 UTSW 8 91,741,877 (GRCm39) missense possibly damaging 0.50
R4912:Chd9 UTSW 8 91,760,858 (GRCm39) missense possibly damaging 0.84
R4977:Chd9 UTSW 8 91,760,336 (GRCm39) missense possibly damaging 0.96
R5016:Chd9 UTSW 8 91,733,254 (GRCm39) nonsense probably null
R5083:Chd9 UTSW 8 91,711,002 (GRCm39) missense probably damaging 1.00
R5088:Chd9 UTSW 8 91,704,147 (GRCm39) missense possibly damaging 0.94
R5090:Chd9 UTSW 8 91,753,462 (GRCm39) nonsense probably null
R5307:Chd9 UTSW 8 91,723,777 (GRCm39) missense probably damaging 1.00
R5541:Chd9 UTSW 8 91,778,132 (GRCm39) missense probably benign 0.09
R5559:Chd9 UTSW 8 91,742,553 (GRCm39) critical splice donor site probably null
R5638:Chd9 UTSW 8 91,738,078 (GRCm39) missense possibly damaging 0.67
R5640:Chd9 UTSW 8 91,763,190 (GRCm39) missense probably damaging 1.00
R5793:Chd9 UTSW 8 91,728,384 (GRCm39) missense probably damaging 1.00
R5827:Chd9 UTSW 8 91,716,078 (GRCm39) missense probably damaging 1.00
R5834:Chd9 UTSW 8 91,723,792 (GRCm39) missense probably damaging 1.00
R5875:Chd9 UTSW 8 91,778,464 (GRCm39) missense probably damaging 0.99
R6002:Chd9 UTSW 8 91,705,515 (GRCm39) missense probably damaging 1.00
R6091:Chd9 UTSW 8 91,761,691 (GRCm39) missense probably damaging 1.00
R6185:Chd9 UTSW 8 91,775,765 (GRCm39) missense probably damaging 1.00
R6246:Chd9 UTSW 8 91,659,045 (GRCm39) missense probably damaging 1.00
R6292:Chd9 UTSW 8 91,659,550 (GRCm39) missense probably benign 0.05
R6305:Chd9 UTSW 8 91,757,174 (GRCm39) missense possibly damaging 0.93
R6348:Chd9 UTSW 8 91,737,903 (GRCm39) missense possibly damaging 0.95
R6438:Chd9 UTSW 8 91,725,149 (GRCm39) missense probably benign 0.02
R6470:Chd9 UTSW 8 91,659,426 (GRCm39) missense probably damaging 1.00
R6798:Chd9 UTSW 8 91,778,182 (GRCm39) missense possibly damaging 0.56
R6902:Chd9 UTSW 8 91,769,579 (GRCm39) missense probably damaging 1.00
R6908:Chd9 UTSW 8 91,683,044 (GRCm39) missense probably benign 0.02
R6929:Chd9 UTSW 8 91,769,573 (GRCm39) missense probably damaging 1.00
R6969:Chd9 UTSW 8 91,705,542 (GRCm39) missense probably benign 0.34
R7043:Chd9 UTSW 8 91,760,843 (GRCm39) utr 3 prime probably benign
R7094:Chd9 UTSW 8 91,716,189 (GRCm39) missense unknown
R7126:Chd9 UTSW 8 91,741,853 (GRCm39) missense unknown
R7182:Chd9 UTSW 8 91,733,250 (GRCm39) missense unknown
R7219:Chd9 UTSW 8 91,728,394 (GRCm39) missense unknown
R7260:Chd9 UTSW 8 91,721,171 (GRCm39) missense unknown
R7293:Chd9 UTSW 8 91,760,707 (GRCm39) missense unknown
R7303:Chd9 UTSW 8 91,778,532 (GRCm39) missense unknown
R7358:Chd9 UTSW 8 91,760,846 (GRCm39) missense unknown
R7358:Chd9 UTSW 8 91,710,115 (GRCm39) missense unknown
R7451:Chd9 UTSW 8 91,760,446 (GRCm39) missense probably benign 0.27
R7451:Chd9 UTSW 8 91,760,418 (GRCm39) frame shift probably null
R7456:Chd9 UTSW 8 91,659,153 (GRCm39) nonsense probably null
R7481:Chd9 UTSW 8 91,683,066 (GRCm39) missense unknown
R7532:Chd9 UTSW 8 91,721,193 (GRCm39) missense unknown
R7570:Chd9 UTSW 8 91,721,208 (GRCm39) missense unknown
R7611:Chd9 UTSW 8 91,763,017 (GRCm39) missense probably damaging 1.00
R7673:Chd9 UTSW 8 91,778,325 (GRCm39) missense probably damaging 0.96
R7723:Chd9 UTSW 8 91,741,837 (GRCm39) missense unknown
R7739:Chd9 UTSW 8 91,761,653 (GRCm39) missense probably damaging 1.00
R7759:Chd9 UTSW 8 91,704,178 (GRCm39) critical splice donor site probably null
R7916:Chd9 UTSW 8 91,761,684 (GRCm39) nonsense probably null
R7921:Chd9 UTSW 8 91,768,909 (GRCm39) critical splice donor site probably null
R7957:Chd9 UTSW 8 91,778,326 (GRCm39) missense probably damaging 0.99
R7972:Chd9 UTSW 8 91,732,395 (GRCm39) missense unknown
R8108:Chd9 UTSW 8 91,659,852 (GRCm39) missense unknown
R8115:Chd9 UTSW 8 91,762,960 (GRCm39) missense probably damaging 0.99
R8165:Chd9 UTSW 8 91,767,769 (GRCm39) missense probably damaging 1.00
R8171:Chd9 UTSW 8 91,752,015 (GRCm39) missense possibly damaging 0.92
R8186:Chd9 UTSW 8 91,725,233 (GRCm39) missense unknown
R8208:Chd9 UTSW 8 91,763,891 (GRCm39) splice site probably null
R8256:Chd9 UTSW 8 91,660,129 (GRCm39) missense unknown
R8281:Chd9 UTSW 8 91,763,225 (GRCm39) missense probably damaging 1.00
R8504:Chd9 UTSW 8 91,723,472 (GRCm39) missense unknown
R8836:Chd9 UTSW 8 91,767,812 (GRCm39) missense probably damaging 0.99
R8892:Chd9 UTSW 8 91,660,468 (GRCm39) missense unknown
R8985:Chd9 UTSW 8 91,721,101 (GRCm39) missense unknown
R9029:Chd9 UTSW 8 91,683,198 (GRCm39) missense unknown
R9030:Chd9 UTSW 8 91,683,198 (GRCm39) missense unknown
R9038:Chd9 UTSW 8 91,716,233 (GRCm39) missense unknown
R9081:Chd9 UTSW 8 91,704,144 (GRCm39) nonsense probably null
R9134:Chd9 UTSW 8 91,659,754 (GRCm39) missense unknown
R9205:Chd9 UTSW 8 91,757,270 (GRCm39) missense probably benign 0.01
R9309:Chd9 UTSW 8 91,733,319 (GRCm39) missense unknown
R9375:Chd9 UTSW 8 91,725,335 (GRCm39) critical splice donor site probably null
R9449:Chd9 UTSW 8 91,659,174 (GRCm39) missense unknown
R9547:Chd9 UTSW 8 91,683,186 (GRCm39) missense unknown
R9573:Chd9 UTSW 8 91,704,302 (GRCm39) missense unknown
R9576:Chd9 UTSW 8 91,659,294 (GRCm39) missense unknown
R9601:Chd9 UTSW 8 91,732,360 (GRCm39) nonsense probably null
R9639:Chd9 UTSW 8 91,760,840 (GRCm39) missense probably null
R9718:Chd9 UTSW 8 91,712,801 (GRCm39) missense unknown
R9746:Chd9 UTSW 8 91,738,063 (GRCm39) missense unknown
R9762:Chd9 UTSW 8 91,712,741 (GRCm39) missense unknown
R9764:Chd9 UTSW 8 91,721,220 (GRCm39) missense unknown
R9790:Chd9 UTSW 8 91,760,417 (GRCm39) missense possibly damaging 0.82
R9791:Chd9 UTSW 8 91,760,417 (GRCm39) missense possibly damaging 0.82
RF007:Chd9 UTSW 8 91,760,578 (GRCm39) missense possibly damaging 0.66
X0065:Chd9 UTSW 8 91,763,200 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTCACATGTCGGCTCTGTC -3'
(R):5'- GCAGGACCTGGAAAACATTAC -3'

Sequencing Primer
(F):5'- ACATGTCGGCTCTGTCATTTTACTG -3'
(R):5'- TGTCTTCTCTTTCAACTTAGAATACG -3'
Posted On 2022-09-12