Incidental Mutation 'R9613:Wapl'
ID 724402
Institutional Source Beutler Lab
Gene Symbol Wapl
Ensembl Gene ENSMUSG00000041408
Gene Name WAPL cohesin release factor
Synonyms A530089A20Rik, Wapal
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9613 (G1)
Quality Score 225.009
Status Not validated
Chromosome 14
Chromosomal Location 34673928-34747983 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 34731563 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 855 (V855A)
Ref Sequence ENSEMBL: ENSMUSP00000040232 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048263] [ENSMUST00000090027] [ENSMUST00000169910]
AlphaFold Q65Z40
Predicted Effect probably benign
Transcript: ENSMUST00000048263
AA Change: V855A

PolyPhen 2 Score 0.290 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000040232
Gene: ENSMUSG00000041408
AA Change: V855A

DomainStartEndE-ValueType
low complexity region 436 455 N/A INTRINSIC
low complexity region 465 477 N/A INTRINSIC
low complexity region 493 513 N/A INTRINSIC
Pfam:WAPL 645 1009 6.5e-153 PFAM
low complexity region 1018 1033 N/A INTRINSIC
low complexity region 1101 1112 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000090027
AA Change: V849A

PolyPhen 2 Score 0.042 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000087481
Gene: ENSMUSG00000041408
AA Change: V849A

DomainStartEndE-ValueType
low complexity region 436 455 N/A INTRINSIC
low complexity region 465 477 N/A INTRINSIC
low complexity region 493 513 N/A INTRINSIC
Pfam:WAPL 639 1003 2.6e-153 PFAM
low complexity region 1012 1027 N/A INTRINSIC
low complexity region 1095 1106 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000117282
Gene: ENSMUSG00000041408
AA Change: V139A

DomainStartEndE-ValueType
Pfam:WAPL 1 281 1.1e-78 PFAM
coiled coil region 329 351 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169910
AA Change: V855A

PolyPhen 2 Score 0.290 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000130547
Gene: ENSMUSG00000041408
AA Change: V855A

DomainStartEndE-ValueType
low complexity region 436 455 N/A INTRINSIC
low complexity region 465 477 N/A INTRINSIC
low complexity region 493 513 N/A INTRINSIC
Pfam:WAPL 647 1008 3.5e-120 PFAM
low complexity region 1018 1033 N/A INTRINSIC
low complexity region 1101 1112 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: Studies suggest that the protein encoded by this gene is important for the release of cohesin from chromatin. This gene product is thought to be essential for development, and reduced expression of this gene in cells causes defects in chromatin structure. High levels of expression of the human ortholog of this gene are observed in cervical cancers, and expression of the human ortholog of this gene in mice results in tumor formation. Alternative splicing results in multiple transcript variants encoding different protein isoforms. [provided by RefSeq, Aug 2014]
PHENOTYPE: Mice homozygous for a targeted allele exhibit prenatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik G A 3: 138,065,365 R105H probably damaging Het
Baz2b A T 2: 59,901,480 N2071K probably benign Het
Chd9 C A 8: 90,956,522 S530* probably null Het
Col6a6 G A 9: 105,739,202 H1558Y probably benign Het
Cyp7a1 A G 4: 6,272,587 F209L probably damaging Het
D430041D05Rik A G 2: 104,230,392 Y702H probably benign Het
Ddx46 T A 13: 55,639,936 probably null Het
Dgat2 C G 7: 99,182,485 G10R probably benign Het
Dync2h1 T A 9: 7,075,769 M3033L probably damaging Het
Eef1g A G 19: 8,977,654 N367S probably benign Het
Eef2kmt T G 16: 5,249,408 E94A possibly damaging Het
Ermp1 C A 19: 29,639,856 probably null Het
Ewsr1 A C 11: 5,078,924 D346E unknown Het
Fam227a G A 15: 79,634,083 T340M probably benign Het
Fxr1 G A 3: 34,046,203 V104I probably benign Het
Gm12394 A G 4: 42,792,992 V380A probably benign Het
Gm6176 A G 7: 22,051,104 V134A possibly damaging Het
Igdcc4 G A 9: 65,120,240 V195I possibly damaging Het
Ighv2-5 A G 12: 113,685,569 I88T Het
Irf8 A T 8: 120,754,468 T355S probably benign Het
Kif20b T A 19: 34,942,534 S751T possibly damaging Het
Kitl A G 10: 100,080,919 N195D probably damaging Het
Kmt2d CTGTTG CTG 15: 98,845,176 probably benign Het
Macf1 A G 4: 123,526,495 F322S probably benign Het
Map6 T C 7: 99,269,177 S386P possibly damaging Het
Nup214 A G 2: 32,011,023 D906G possibly damaging Het
Oacyl A C 18: 65,731,453 T356P probably damaging Het
Olfr388-ps1 A T 11: 73,724,813 D70E probably damaging Het
Olfr521 A G 7: 99,767,329 T56A probably benign Het
Plekha1 C A 7: 130,877,758 P2H probably damaging Het
Plekhg4 T A 8: 105,380,988 D1050E probably damaging Het
Plxnb2 T C 15: 89,164,293 T638A probably benign Het
Pole4 T C 6: 82,652,118 Q89R probably benign Het
Prg4 T C 1: 150,455,909 T338A unknown Het
Prpf3 G A 3: 95,851,619 R74* probably null Het
Prss44 C A 9: 110,814,738 A150E probably damaging Het
Prss51 T A 14: 64,095,012 V2E possibly damaging Het
Ptpn12 A G 5: 20,998,623 Y386H probably damaging Het
Sept4 A T 11: 87,578,997 H3L possibly damaging Het
Spata16 G A 3: 26,878,665 V347M probably damaging Het
Spinkl T A 18: 44,168,145 Y42F probably damaging Het
Suds3 A T 5: 117,105,169 M168K possibly damaging Het
Tdrd6 A G 17: 43,628,627 I510T probably damaging Het
Tnfrsf22 T C 7: 143,644,846 H44R probably benign Het
Trh G A 6: 92,242,859 R159* probably null Het
Ubr4 C A 4: 139,421,762 S457R Het
Usp54 T C 14: 20,550,370 Y1433C probably damaging Het
Vmn1r120 G A 7: 21,053,121 L222F probably benign Het
Vmn2r22 T C 6: 123,638,116 I172V probably damaging Het
Vmn2r84 A G 10: 130,390,722 S416P probably damaging Het
Zmynd19 A G 2: 24,958,205 I177V Het
Zscan4e G A 7: 11,306,971 Q325* probably null Het
Other mutations in Wapl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00335:Wapl APN 14 34692636 missense probably benign 0.00
IGL00539:Wapl APN 14 34695008 missense probably damaging 1.00
IGL00846:Wapl APN 14 34692744 splice site probably benign
IGL01070:Wapl APN 14 34745622 unclassified probably benign
IGL01516:Wapl APN 14 34692081 missense probably damaging 1.00
IGL02021:Wapl APN 14 34722336 missense probably benign
IGL02209:Wapl APN 14 34677261 missense possibly damaging 0.46
IGL02309:Wapl APN 14 34744863 missense probably damaging 0.98
IGL02471:Wapl APN 14 34691920 missense possibly damaging 0.68
IGL02965:Wapl APN 14 34739224 intron probably benign
IGL03076:Wapl APN 14 34692089 missense probably benign 0.26
IGL03197:Wapl APN 14 34745631 missense possibly damaging 0.77
Mcclintock UTSW 14 34730662 critical splice donor site probably null
Tatum UTSW 14 34729195 missense probably damaging 1.00
R0045:Wapl UTSW 14 34733794 missense probably benign 0.18
R0278:Wapl UTSW 14 34692612 missense possibly damaging 0.68
R0335:Wapl UTSW 14 34692324 missense probably damaging 0.99
R1018:Wapl UTSW 14 34691906 missense possibly damaging 0.91
R1295:Wapl UTSW 14 34724769 missense probably damaging 1.00
R1553:Wapl UTSW 14 34729190 missense probably damaging 1.00
R1868:Wapl UTSW 14 34692458 missense probably benign 0.00
R1909:Wapl UTSW 14 34691912 missense probably damaging 1.00
R2698:Wapl UTSW 14 34691777 missense probably benign
R2990:Wapl UTSW 14 34736708 missense probably damaging 0.98
R3121:Wapl UTSW 14 34729215 missense possibly damaging 0.93
R3122:Wapl UTSW 14 34729215 missense possibly damaging 0.93
R3147:Wapl UTSW 14 34725149 missense probably damaging 1.00
R3732:Wapl UTSW 14 34736764 missense probably damaging 0.99
R3732:Wapl UTSW 14 34736764 missense probably damaging 0.99
R3733:Wapl UTSW 14 34736764 missense probably damaging 0.99
R3878:Wapl UTSW 14 34692147 missense probably damaging 1.00
R4034:Wapl UTSW 14 34737914 missense possibly damaging 0.92
R4934:Wapl UTSW 14 34692095 missense probably benign 0.11
R5079:Wapl UTSW 14 34724757 missense probably damaging 1.00
R5104:Wapl UTSW 14 34692059 nonsense probably null
R5113:Wapl UTSW 14 34724754 missense probably damaging 1.00
R5121:Wapl UTSW 14 34677162 missense probably benign 0.01
R5222:Wapl UTSW 14 34736685 nonsense probably null
R5299:Wapl UTSW 14 34733808 critical splice donor site probably null
R5387:Wapl UTSW 14 34677295 missense probably benign 0.00
R5541:Wapl UTSW 14 34730662 critical splice donor site probably null
R5618:Wapl UTSW 14 34691906 missense possibly damaging 0.91
R5802:Wapl UTSW 14 34692320 missense probably damaging 1.00
R6029:Wapl UTSW 14 34739247 missense possibly damaging 0.94
R6292:Wapl UTSW 14 34729195 missense probably damaging 1.00
R6482:Wapl UTSW 14 34692692 missense probably benign 0.01
R6487:Wapl UTSW 14 34692292 missense probably damaging 1.00
R6925:Wapl UTSW 14 34677363 missense probably benign 0.31
R6937:Wapl UTSW 14 34722354 missense probably benign 0.01
R7080:Wapl UTSW 14 34692356 missense probably benign 0.03
R7203:Wapl UTSW 14 34736691 missense probably benign
R7944:Wapl UTSW 14 34677148 missense probably benign 0.00
R7945:Wapl UTSW 14 34677148 missense probably benign 0.00
R7969:Wapl UTSW 14 34730647 missense probably damaging 1.00
R8038:Wapl UTSW 14 34691682 missense probably benign
R8053:Wapl UTSW 14 34692321 missense probably damaging 1.00
R8688:Wapl UTSW 14 34692592 missense possibly damaging 0.94
R8864:Wapl UTSW 14 34692202 missense probably benign 0.03
R8988:Wapl UTSW 14 34729182 missense probably damaging 1.00
R9072:Wapl UTSW 14 34677460 missense possibly damaging 0.81
R9197:Wapl UTSW 14 34722287 missense probably damaging 1.00
R9259:Wapl UTSW 14 34741095 missense probably benign 0.00
R9545:Wapl UTSW 14 34677093 missense probably damaging 1.00
R9624:Wapl UTSW 14 34692106 missense possibly damaging 0.89
Z1177:Wapl UTSW 14 34745690 makesense probably null
Predicted Primers PCR Primer
(F):5'- TGTTCCCATTCCAGCATATACG -3'
(R):5'- AGCCATGACATGACTGTGTTTG -3'

Sequencing Primer
(F):5'- CCAGCATATACGTATTCATAGCATG -3'
(R):5'- ATGCCCATTTACTGACAGTTGG -3'
Posted On 2022-09-12