Incidental Mutation 'R0762:Mthfr'
ID72443
Institutional Source Beutler Lab
Gene Symbol Mthfr
Ensembl Gene ENSMUSG00000029009
Gene Namemethylenetetrahydrofolate reductase
Synonyms
MMRRC Submission 038942-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.757) question?
Stock #R0762 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location148039077-148059551 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 148055443 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 623 (I623T)
Ref Sequence ENSEMBL: ENSMUSP00000117095 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069604] [ENSMUST00000097788] [ENSMUST00000152498]
Predicted Effect possibly damaging
Transcript: ENSMUST00000069604
AA Change: I648T

PolyPhen 2 Score 0.653 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000069774
Gene: ENSMUSG00000029009
AA Change: I648T

DomainStartEndE-ValueType
low complexity region 48 73 N/A INTRINSIC
Pfam:MTHFR 88 377 2.3e-121 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000097788
AA Change: I607T

PolyPhen 2 Score 0.116 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000095395
Gene: ENSMUSG00000029009
AA Change: I607T

DomainStartEndE-ValueType
low complexity region 7 32 N/A INTRINSIC
Pfam:MTHFR 47 336 5.9e-121 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000152498
AA Change: I623T

PolyPhen 2 Score 0.653 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000117095
Gene: ENSMUSG00000029009
AA Change: I623T

DomainStartEndE-ValueType
low complexity region 23 48 N/A INTRINSIC
Pfam:MTHFR 63 352 2.4e-121 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000156113
AA Change: I104T
Meta Mutation Damage Score 0.4433 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 93.9%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes the conversion of 5,10-methylenetetrahydrofolate to 5-methyltetrahydrofolate, a co-substrate for homocysteine remethylation to methionine. Genetic variation in this gene influences susceptibility to occlusive vascular disease, neural tube defects, colon cancer and acute leukemia, and mutations in this gene are associated with methylenetetrahydrofolate reductase deficiency.[provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for disruptions in this gene have elevated plasma levels of homocysteine. They also display delayed growth and development and a reduced survival rate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik A G 15: 8,218,416 probably benign Het
4921504E06Rik T A 2: 19,477,856 N475I probably damaging Het
Adar T C 3: 89,739,983 probably benign Het
Aldh3b3 A T 19: 3,965,747 probably null Het
Amtn C T 5: 88,385,000 T158I possibly damaging Het
Ap1g2 A G 14: 55,100,411 probably benign Het
Arhgef3 A G 14: 27,397,627 Y318C probably damaging Het
Atg2b A C 12: 105,674,970 V69G possibly damaging Het
Bbx G A 16: 50,225,166 T236I possibly damaging Het
Bcl11b C T 12: 107,965,663 probably benign Het
Catsperg1 T C 7: 29,189,952 I794V probably benign Het
Ccdc88a C T 11: 29,463,112 probably benign Het
Cdhr3 C A 12: 33,060,301 R328L probably benign Het
Ces2e T A 8: 104,929,864 M242K probably damaging Het
Col12a1 A G 9: 79,681,374 probably benign Het
Col3a1 T C 1: 45,321,526 S39P unknown Het
Cyp2a5 T A 7: 26,838,873 Y220* probably null Het
D3Ertd254e G A 3: 36,165,867 D680N possibly damaging Het
Dcc T A 18: 71,342,705 probably benign Het
Dnajb8 A G 6: 88,223,054 T191A probably damaging Het
Ephx2 A T 14: 66,102,179 F199I probably damaging Het
Fancd2 A G 6: 113,574,658 K1062E probably benign Het
Fbxo33 A G 12: 59,204,499 V410A probably benign Het
Gars T G 6: 55,077,580 probably null Het
Git1 A C 11: 77,499,834 D132A possibly damaging Het
Gm853 A G 4: 130,221,624 S44P probably damaging Het
Gp1ba C T 11: 70,641,427 P673L probably damaging Het
Gucy1a1 T C 3: 82,094,896 T44A unknown Het
Hjurp G C 1: 88,277,215 probably benign Het
Ifnlr1 A G 4: 135,701,329 K156E possibly damaging Het
Klf13 T C 7: 63,891,623 N15S probably benign Het
Krt77 T C 15: 101,861,126 probably null Het
Map4 C A 9: 110,038,478 probably benign Het
Myo7b T A 18: 31,983,944 T908S probably benign Het
Nbeal2 T G 9: 110,643,808 probably benign Het
Nwd2 T G 5: 63,800,414 F362L probably benign Het
Pcm1 A T 8: 41,261,020 R208W probably damaging Het
Pkd2l1 T C 19: 44,150,470 D647G probably benign Het
Plbd1 C T 6: 136,641,147 V24M probably damaging Het
Polr2a G A 11: 69,735,117 P1698S unknown Het
Prss12 T C 3: 123,485,504 I410T probably damaging Het
Ptpre A G 7: 135,679,235 N565S probably damaging Het
Rab44 T C 17: 29,145,270 L606P unknown Het
Rbm10 C T X: 20,637,664 probably benign Het
Rhd C T 4: 134,876,301 probably benign Het
Rspo3 T A 10: 29,499,921 probably benign Het
Sdccag8 T A 1: 176,946,144 N555K probably benign Het
Skint6 T A 4: 112,865,651 probably benign Het
Slc22a20 G A 19: 5,986,008 P45S probably damaging Het
Slc5a2 A G 7: 128,267,482 Y124C probably damaging Het
Spats2l T C 1: 57,885,884 L127P possibly damaging Het
Taar8a T A 10: 24,077,077 I193N probably benign Het
Ten1 C T 11: 116,216,684 probably benign Het
Tfb2m T C 1: 179,545,833 E100G probably damaging Het
Tom1 C T 8: 75,052,306 probably benign Het
Vps52 G T 17: 33,960,011 R171L probably damaging Het
Zcwpw2 A T 9: 118,014,114 noncoding transcript Het
Zfhx4 G A 3: 5,403,820 E3013K probably damaging Het
Zfp777 C T 6: 48,029,360 V411M probably damaging Het
Other mutations in Mthfr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Mthfr APN 4 148041270 missense probably benign
IGL00911:Mthfr APN 4 148041302 missense probably benign 0.01
R0116:Mthfr UTSW 4 148051523 missense probably benign 0.00
R0207:Mthfr UTSW 4 148052224 missense probably damaging 1.00
R0268:Mthfr UTSW 4 148055428 missense probably damaging 1.00
R0344:Mthfr UTSW 4 148055428 missense probably damaging 1.00
R1433:Mthfr UTSW 4 148055443 missense possibly damaging 0.92
R1464:Mthfr UTSW 4 148053572 splice site probably benign
R1972:Mthfr UTSW 4 148051927 missense probably damaging 1.00
R3154:Mthfr UTSW 4 148051604 missense probably benign 0.12
R3407:Mthfr UTSW 4 148055061 missense probably damaging 1.00
R3773:Mthfr UTSW 4 148044450 missense probably benign 0.00
R4153:Mthfr UTSW 4 148051475 missense probably damaging 0.99
R4291:Mthfr UTSW 4 148055492 missense probably damaging 1.00
R4487:Mthfr UTSW 4 148051427 missense probably benign 0.00
R4574:Mthfr UTSW 4 148043541 missense possibly damaging 0.95
R4583:Mthfr UTSW 4 148051872 missense possibly damaging 0.80
R4847:Mthfr UTSW 4 148048139 missense probably damaging 0.99
R5183:Mthfr UTSW 4 148051360 splice site probably null
R5536:Mthfr UTSW 4 148044483 missense probably damaging 1.00
R5664:Mthfr UTSW 4 148055466 missense probably damaging 1.00
R6161:Mthfr UTSW 4 148041754 missense probably benign 0.35
R7285:Mthfr UTSW 4 148053599 missense probably benign 0.01
R7427:Mthfr UTSW 4 148051603 missense probably benign 0.00
R7428:Mthfr UTSW 4 148051603 missense probably benign 0.00
R7474:Mthfr UTSW 4 148052602 missense possibly damaging 0.95
R7823:Mthfr UTSW 4 148051487 missense probably benign 0.29
R7826:Mthfr UTSW 4 148055010 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTGGCCCTGAAGGCCGTATGTTAG -3'
(R):5'- CAAAGTTCACCTCCTAGAGGCTGC -3'

Sequencing Primer
(F):5'- CTAGCTTGGAGTGGCTCTGTC -3'
(R):5'- CATCTTAGGTCCAGCCAGAG -3'
Posted On2013-09-30