Incidental Mutation 'R9614:Ticrr'
ID 724442
Institutional Source Beutler Lab
Gene Symbol Ticrr
Ensembl Gene ENSMUSG00000046591
Gene Name TOPBP1-interacting checkpoint and replication regulator
Synonyms 5730590G19Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.950) question?
Stock # R9614 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 79660196-79698148 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 79696006 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 1836 (S1836P)
Ref Sequence ENSEMBL: ENSMUSP00000041377 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035977] [ENSMUST00000059836] [ENSMUST00000178048] [ENSMUST00000183846] [ENSMUST00000184137] [ENSMUST00000206591] [ENSMUST00000206622]
AlphaFold Q8BQ33
Predicted Effect probably damaging
Transcript: ENSMUST00000035977
AA Change: S1836P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000041377
Gene: ENSMUSG00000046591
AA Change: S1836P

DomainStartEndE-ValueType
low complexity region 23 31 N/A INTRINSIC
Pfam:Treslin_N 211 1005 N/A PFAM
low complexity region 1186 1197 N/A INTRINSIC
low complexity region 1220 1235 N/A INTRINSIC
low complexity region 1339 1359 N/A INTRINSIC
low complexity region 1472 1480 N/A INTRINSIC
low complexity region 1496 1514 N/A INTRINSIC
low complexity region 1630 1643 N/A INTRINSIC
low complexity region 1694 1707 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000059836
SMART Domains Protein: ENSMUSP00000061806
Gene: ENSMUSG00000050382

DomainStartEndE-ValueType
KISc 13 357 2.88e-143 SMART
low complexity region 391 410 N/A INTRINSIC
Blast:KISc 413 481 1e-19 BLAST
Blast:KISc 482 518 3e-11 BLAST
low complexity region 523 540 N/A INTRINSIC
low complexity region 543 557 N/A INTRINSIC
low complexity region 621 636 N/A INTRINSIC
low complexity region 669 685 N/A INTRINSIC
Blast:KISc 780 879 2e-15 BLAST
low complexity region 927 944 N/A INTRINSIC
low complexity region 979 993 N/A INTRINSIC
low complexity region 1049 1061 N/A INTRINSIC
coiled coil region 1113 1139 N/A INTRINSIC
coiled coil region 1186 1205 N/A INTRINSIC
low complexity region 1293 1304 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000178048
SMART Domains Protein: ENSMUSP00000136993
Gene: ENSMUSG00000050382

DomainStartEndE-ValueType
KISc 13 357 2.88e-143 SMART
low complexity region 391 410 N/A INTRINSIC
Blast:KISc 413 481 1e-19 BLAST
Blast:KISc 482 518 3e-11 BLAST
low complexity region 523 540 N/A INTRINSIC
low complexity region 543 557 N/A INTRINSIC
low complexity region 621 636 N/A INTRINSIC
low complexity region 669 685 N/A INTRINSIC
Blast:KISc 780 879 2e-15 BLAST
low complexity region 908 918 N/A INTRINSIC
low complexity region 928 945 N/A INTRINSIC
low complexity region 980 994 N/A INTRINSIC
low complexity region 1050 1062 N/A INTRINSIC
coiled coil region 1114 1140 N/A INTRINSIC
coiled coil region 1187 1206 N/A INTRINSIC
low complexity region 1294 1305 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183846
SMART Domains Protein: ENSMUSP00000139359
Gene: ENSMUSG00000050382

DomainStartEndE-ValueType
KISc 13 357 2.88e-143 SMART
low complexity region 391 410 N/A INTRINSIC
Blast:KISc 413 481 1e-19 BLAST
Blast:KISc 482 518 3e-11 BLAST
low complexity region 523 540 N/A INTRINSIC
low complexity region 543 557 N/A INTRINSIC
low complexity region 621 636 N/A INTRINSIC
low complexity region 669 685 N/A INTRINSIC
Blast:KISc 780 879 2e-15 BLAST
low complexity region 908 918 N/A INTRINSIC
low complexity region 928 945 N/A INTRINSIC
low complexity region 980 994 N/A INTRINSIC
low complexity region 1050 1062 N/A INTRINSIC
coiled coil region 1114 1140 N/A INTRINSIC
coiled coil region 1187 1206 N/A INTRINSIC
low complexity region 1294 1305 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000184137
SMART Domains Protein: ENSMUSP00000139224
Gene: ENSMUSG00000050382

DomainStartEndE-ValueType
KISc 13 357 2.88e-143 SMART
low complexity region 391 410 N/A INTRINSIC
Blast:KISc 413 481 1e-19 BLAST
Blast:KISc 482 518 3e-11 BLAST
low complexity region 523 540 N/A INTRINSIC
low complexity region 543 557 N/A INTRINSIC
low complexity region 621 636 N/A INTRINSIC
low complexity region 669 685 N/A INTRINSIC
Blast:KISc 780 879 2e-15 BLAST
low complexity region 927 944 N/A INTRINSIC
low complexity region 979 993 N/A INTRINSIC
low complexity region 1049 1061 N/A INTRINSIC
coiled coil region 1113 1139 N/A INTRINSIC
coiled coil region 1186 1205 N/A INTRINSIC
low complexity region 1293 1304 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000206591
Predicted Effect probably benign
Transcript: ENSMUST00000206622
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Treslin is involved in the initiation of DNA replication (Kumagai et al., 2010 [PubMed 20116089]).[supplied by OMIM, Apr 2010]
PHENOTYPE: Mice homozygous for an ENU-induced allele are mostly hairless, with only a light patch of hair around the face and tail. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810055G02Rik C T 19: 3,717,364 T317I possibly damaging Het
Adamts7 T A 9: 90,195,198 V1306E probably damaging Het
Adcy9 C T 16: 4,288,683 D1093N probably damaging Het
Adgra3 A G 5: 50,006,908 V243A probably damaging Het
Aqp4 C T 18: 15,393,630 A265T probably benign Het
Atad2 A T 15: 58,106,723 probably null Het
Atp13a4 A G 16: 29,441,580 V560A Het
Best2 A C 8: 85,013,422 C38G Het
Bicra A T 7: 15,971,955 S1520R probably damaging Het
C1s2 A G 6: 124,625,629 L541P probably damaging Het
Calcoco2 T A 11: 96,100,359 H184L probably benign Het
Cav1 A T 6: 17,339,404 I163F probably benign Het
Ccdc151 T C 9: 21,993,014 D322G probably benign Het
Cep57l1 T C 10: 41,721,567 H356R probably damaging Het
Clu A C 14: 65,971,402 H32P unknown Het
Col5a1 T A 2: 27,989,174 D840E unknown Het
Cramp1l C A 17: 24,982,809 K566N probably damaging Het
Csmd1 C A 8: 16,158,225 V1239L probably benign Het
Cubn T A 2: 13,478,134 Q267L probably benign Het
Cul7 C T 17: 46,664,286 R1689W probably damaging Het
Dao A T 5: 114,013,999 D126V probably benign Het
Eif3l T C 15: 79,094,223 M560T probably benign Het
F830016B08Rik T A 18: 60,300,307 I154N probably damaging Het
Fam184a T C 10: 53,641,048 E980G probably damaging Het
Fgf21 T C 7: 45,615,279 T10A probably benign Het
Fhad1 A C 4: 141,951,571 V598G possibly damaging Het
Foxc1 A T 13: 31,807,880 I225F possibly damaging Het
Foxo3 C T 10: 42,197,025 V499M probably damaging Het
Galnt9 G A 5: 110,596,181 G294S probably damaging Het
Gp5 A C 16: 30,309,575 F94V probably damaging Het
Idh2 A T 7: 80,098,177 Y258* probably null Het
Immp2l T C 12: 41,110,934 V77A probably damaging Het
Isl1 T C 13: 116,305,388 E103G Het
Itgad A T 7: 128,203,850 T1059S probably damaging Het
Kcnj6 G A 16: 94,832,448 T268I probably damaging Het
Lgals3bp A G 11: 118,393,211 V514A probably benign Het
Mcfd2 A T 17: 87,257,993 H27Q probably benign Het
Mettl13 A G 1: 162,537,200 W537R probably damaging Het
Mybl2 G T 2: 163,064,305 G102V probably damaging Het
Nars2 C T 7: 97,039,918 T349M probably damaging Het
Nat8f3 A T 6: 85,761,726 V18E Het
Npepps T C 11: 97,258,351 E115G probably benign Het
Olfr1057 A G 2: 86,374,668 V248A probably damaging Het
Olfr1382 T A 11: 49,535,244 W20R probably damaging Het
Olfr834 A T 9: 18,988,230 M81L possibly damaging Het
Olfr926 G A 9: 38,877,985 V270M probably damaging Het
Oog2 T A 4: 144,196,137 V324E probably damaging Het
Pdzd2 A G 15: 12,375,400 S1550P probably damaging Het
Peg10 T TCCC 6: 4,756,451 probably benign Het
Pms2 T C 5: 143,917,602 V243A probably benign Het
Ptpn9 A G 9: 57,036,721 D293G probably benign Het
Ptprb A G 10: 116,367,536 K1784R probably damaging Het
Rab23 CAA CA 1: 33,724,996 probably null Het
Raf1 T C 6: 115,619,636 N576D probably benign Het
Rasa4 C A 5: 136,111,489 H782Q possibly damaging Het
Rims1 C A 1: 22,421,745 E168* probably null Het
Rpgrip1l A T 8: 91,260,806 N874K possibly damaging Het
Rxfp4 C T 3: 88,652,662 V161I possibly damaging Het
Scel G A 14: 103,605,596 G558D probably damaging Het
Sipa1l2 T C 8: 125,469,826 K723R probably null Het
Slc12a1 A T 2: 125,160,525 R142W probably damaging Het
Slc27a2 T A 2: 126,567,816 V306D probably damaging Het
Sox4 C T 13: 28,952,096 G309D probably damaging Het
Terb1 T C 8: 104,496,844 T111A probably benign Het
Tgfa G A 6: 86,271,415 R133H probably damaging Het
Tlk2 A G 11: 105,247,502 D292G probably benign Het
Tmc7 A G 7: 118,541,937 I657T probably benign Het
Tmprss11c G A 5: 86,235,520 T349I probably benign Het
Trhr A G 15: 44,197,585 N167S probably benign Het
Tsc22d1 T G 14: 76,416,543 I154S probably damaging Het
Vmn1r2 T C 4: 3,172,587 Y169H probably damaging Het
Vmn1r77 G T 7: 12,041,839 V181L probably benign Het
Other mutations in Ticrr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Ticrr APN 7 79677283 missense probably damaging 1.00
IGL00596:Ticrr APN 7 79677293 missense probably damaging 1.00
IGL01327:Ticrr APN 7 79694461 missense probably benign 0.00
IGL01525:Ticrr APN 7 79682449 missense probably damaging 1.00
IGL01565:Ticrr APN 7 79694548 missense probably benign
IGL01936:Ticrr APN 7 79694549 missense probably benign 0.11
IGL02160:Ticrr APN 7 79694019 missense probably benign 0.29
IGL02246:Ticrr APN 7 79675328 missense probably damaging 1.00
IGL02487:Ticrr APN 7 79683021 missense possibly damaging 0.86
IGL02593:Ticrr APN 7 79695466 missense probably damaging 0.99
IGL02970:Ticrr APN 7 79695171 missense probably benign 0.01
FR4304:Ticrr UTSW 7 79694311 intron probably benign
PIT4305001:Ticrr UTSW 7 79679023 missense possibly damaging 0.95
PIT4791001:Ticrr UTSW 7 79669638 missense possibly damaging 0.92
R0016:Ticrr UTSW 7 79693792 missense probably benign 0.01
R0062:Ticrr UTSW 7 79667906 missense probably benign 0.01
R0062:Ticrr UTSW 7 79667906 missense probably benign 0.01
R0067:Ticrr UTSW 7 79677410 missense probably damaging 1.00
R0067:Ticrr UTSW 7 79677410 missense probably damaging 1.00
R0362:Ticrr UTSW 7 79677340 missense probably damaging 1.00
R0482:Ticrr UTSW 7 79694488 missense probably damaging 0.99
R0595:Ticrr UTSW 7 79695563 missense possibly damaging 0.94
R1118:Ticrr UTSW 7 79693953 missense probably benign 0.23
R1119:Ticrr UTSW 7 79693953 missense probably benign 0.23
R1572:Ticrr UTSW 7 79681824 missense probably damaging 1.00
R1658:Ticrr UTSW 7 79695549 missense possibly damaging 0.57
R1757:Ticrr UTSW 7 79675323 missense probably damaging 0.99
R1757:Ticrr UTSW 7 79679046 nonsense probably null
R1862:Ticrr UTSW 7 79695207 missense probably damaging 1.00
R1869:Ticrr UTSW 7 79679135 missense probably damaging 1.00
R1938:Ticrr UTSW 7 79675394 missense probably damaging 0.98
R1966:Ticrr UTSW 7 79694735 nonsense probably null
R2006:Ticrr UTSW 7 79694073 missense possibly damaging 0.93
R2178:Ticrr UTSW 7 79665685 missense probably benign 0.12
R3404:Ticrr UTSW 7 79694791 missense probably benign 0.06
R3405:Ticrr UTSW 7 79694791 missense probably benign 0.06
R3941:Ticrr UTSW 7 79693697 intron probably benign
R3950:Ticrr UTSW 7 79682069 missense probably damaging 1.00
R3951:Ticrr UTSW 7 79682069 missense probably damaging 1.00
R3952:Ticrr UTSW 7 79682069 missense probably damaging 1.00
R4967:Ticrr UTSW 7 79660410 missense probably damaging 0.99
R4972:Ticrr UTSW 7 79669668 missense probably damaging 0.98
R5259:Ticrr UTSW 7 79694723 missense probably benign 0.01
R5272:Ticrr UTSW 7 79669605 missense probably benign 0.44
R5374:Ticrr UTSW 7 79690942 nonsense probably null
R5480:Ticrr UTSW 7 79660809 missense probably damaging 1.00
R5568:Ticrr UTSW 7 79689967 critical splice donor site probably null
R5568:Ticrr UTSW 7 79695296 nonsense probably null
R5588:Ticrr UTSW 7 79679105 missense probably damaging 1.00
R5698:Ticrr UTSW 7 79679133 missense probably benign
R5879:Ticrr UTSW 7 79696690 missense probably benign 0.12
R5980:Ticrr UTSW 7 79660955 missense probably damaging 0.99
R6128:Ticrr UTSW 7 79693968 missense probably damaging 1.00
R6277:Ticrr UTSW 7 79694696 missense probably benign 0.00
R6335:Ticrr UTSW 7 79694283 splice site probably null
R6866:Ticrr UTSW 7 79693957 missense possibly damaging 0.47
R6905:Ticrr UTSW 7 79665850 missense probably benign 0.00
R6923:Ticrr UTSW 7 79691853 missense probably damaging 0.98
R6962:Ticrr UTSW 7 79665897 missense possibly damaging 0.84
R7232:Ticrr UTSW 7 79693742 missense probably damaging 0.96
R7285:Ticrr UTSW 7 79660862 missense possibly damaging 0.93
R7385:Ticrr UTSW 7 79691849 missense possibly damaging 0.93
R7426:Ticrr UTSW 7 79693986 missense probably benign
R7583:Ticrr UTSW 7 79696739 nonsense probably null
R7749:Ticrr UTSW 7 79679096 missense possibly damaging 0.94
R7863:Ticrr UTSW 7 79682012 missense possibly damaging 0.92
R7899:Ticrr UTSW 7 79669485 missense probably benign 0.23
R7935:Ticrr UTSW 7 79681836 missense probably damaging 0.99
R8005:Ticrr UTSW 7 79694048 missense probably damaging 0.98
R8080:Ticrr UTSW 7 79684264 splice site probably null
R8181:Ticrr UTSW 7 79660980 missense possibly damaging 0.92
R8349:Ticrr UTSW 7 79694680 missense probably benign 0.27
R8410:Ticrr UTSW 7 79667675 missense probably damaging 0.98
R8449:Ticrr UTSW 7 79694680 missense probably benign 0.27
R9073:Ticrr UTSW 7 79667931 missense probably benign 0.01
R9090:Ticrr UTSW 7 79660856 missense possibly damaging 0.85
R9271:Ticrr UTSW 7 79660856 missense possibly damaging 0.85
R9287:Ticrr UTSW 7 79693768 missense possibly damaging 0.89
R9368:Ticrr UTSW 7 79680987 missense probably damaging 0.99
R9469:Ticrr UTSW 7 79694763 missense probably benign 0.03
R9502:Ticrr UTSW 7 79693849 missense probably benign
R9761:Ticrr UTSW 7 79695565 missense probably damaging 1.00
R9779:Ticrr UTSW 7 79679054 missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- TACCACTCCACTCAGTAGGG -3'
(R):5'- TGCCCTAAGTTCTACAATGAAGC -3'

Sequencing Primer
(F):5'- CACTCAGTAGGGGACGACG -3'
(R):5'- GTTCTACAATGAAGCCTCTTTAGG -3'
Posted On 2022-09-12