Incidental Mutation 'R0762:Zfp777'
ID72446
Institutional Source Beutler Lab
Gene Symbol Zfp777
Ensembl Gene ENSMUSG00000071477
Gene Namezinc finger protein 777
Synonyms
MMRRC Submission 038942-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.337) question?
Stock #R0762 (G1)
Quality Score216
Status Validated
Chromosome6
Chromosomal Location48024188-48048911 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 48029360 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 411 (V411M)
Ref Sequence ENSEMBL: ENSMUSP00000110230 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095944] [ENSMUST00000114583]
Predicted Effect probably damaging
Transcript: ENSMUST00000095944
AA Change: V367M

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000093637
Gene: ENSMUSG00000071477
AA Change: V367M

DomainStartEndE-ValueType
Pfam:DUF3669 177 256 4.3e-12 PFAM
KRAB 284 344 1.6e-29 SMART
low complexity region 422 433 N/A INTRINSIC
coiled coil region 454 477 N/A INTRINSIC
low complexity region 489 505 N/A INTRINSIC
low complexity region 520 532 N/A INTRINSIC
low complexity region 539 555 N/A INTRINSIC
ZnF_C2H2 557 579 1.2e-5 SMART
ZnF_C2H2 585 607 3.8e-5 SMART
ZnF_C2H2 646 668 1.1e-6 SMART
ZnF_C2H2 674 696 4.6e-6 SMART
ZnF_C2H2 704 726 3.2e-7 SMART
ZnF_C2H2 732 754 3.3e-6 SMART
ZnF_C2H2 760 782 8.4e-6 SMART
ZnF_C2H2 788 810 4.9e-5 SMART
ZnF_C2H2 816 838 1.1e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000114583
AA Change: V411M

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000110230
Gene: ENSMUSG00000071477
AA Change: V411M

DomainStartEndE-ValueType
low complexity region 2 24 N/A INTRINSIC
Pfam:DUF3669 231 298 4.7e-12 PFAM
KRAB 328 388 3.96e-27 SMART
low complexity region 466 477 N/A INTRINSIC
coiled coil region 498 521 N/A INTRINSIC
low complexity region 533 549 N/A INTRINSIC
low complexity region 564 576 N/A INTRINSIC
low complexity region 583 599 N/A INTRINSIC
ZnF_C2H2 601 623 2.95e-3 SMART
ZnF_C2H2 629 651 8.94e-3 SMART
ZnF_C2H2 690 712 2.43e-4 SMART
ZnF_C2H2 718 740 1.12e-3 SMART
ZnF_C2H2 748 770 7.49e-5 SMART
ZnF_C2H2 776 798 7.9e-4 SMART
ZnF_C2H2 804 826 1.95e-3 SMART
ZnF_C2H2 832 854 1.18e-2 SMART
ZnF_C2H2 860 882 2.53e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000148362
SMART Domains Protein: ENSMUSP00000116303
Gene: ENSMUSG00000071477

DomainStartEndE-ValueType
Pfam:DUF3669 40 107 6.1e-13 PFAM
KRAB 137 197 3.96e-27 SMART
Meta Mutation Damage Score 0.1511 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 93.9%
Validation Efficiency 100% (61/61)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik A G 15: 8,218,416 probably benign Het
4921504E06Rik T A 2: 19,477,856 N475I probably damaging Het
Adar T C 3: 89,739,983 probably benign Het
Aldh3b3 A T 19: 3,965,747 probably null Het
Amtn C T 5: 88,385,000 T158I possibly damaging Het
Ap1g2 A G 14: 55,100,411 probably benign Het
Arhgef3 A G 14: 27,397,627 Y318C probably damaging Het
Atg2b A C 12: 105,674,970 V69G possibly damaging Het
Bbx G A 16: 50,225,166 T236I possibly damaging Het
Bcl11b C T 12: 107,965,663 probably benign Het
Catsperg1 T C 7: 29,189,952 I794V probably benign Het
Ccdc88a C T 11: 29,463,112 probably benign Het
Cdhr3 C A 12: 33,060,301 R328L probably benign Het
Ces2e T A 8: 104,929,864 M242K probably damaging Het
Col12a1 A G 9: 79,681,374 probably benign Het
Col3a1 T C 1: 45,321,526 S39P unknown Het
Cyp2a5 T A 7: 26,838,873 Y220* probably null Het
D3Ertd254e G A 3: 36,165,867 D680N possibly damaging Het
Dcc T A 18: 71,342,705 probably benign Het
Dnajb8 A G 6: 88,223,054 T191A probably damaging Het
Ephx2 A T 14: 66,102,179 F199I probably damaging Het
Fancd2 A G 6: 113,574,658 K1062E probably benign Het
Fbxo33 A G 12: 59,204,499 V410A probably benign Het
Gars T G 6: 55,077,580 probably null Het
Git1 A C 11: 77,499,834 D132A possibly damaging Het
Gm853 A G 4: 130,221,624 S44P probably damaging Het
Gp1ba C T 11: 70,641,427 P673L probably damaging Het
Gucy1a1 T C 3: 82,094,896 T44A unknown Het
Hjurp G C 1: 88,277,215 probably benign Het
Ifnlr1 A G 4: 135,701,329 K156E possibly damaging Het
Klf13 T C 7: 63,891,623 N15S probably benign Het
Krt77 T C 15: 101,861,126 probably null Het
Map4 C A 9: 110,038,478 probably benign Het
Mthfr T C 4: 148,055,443 I623T possibly damaging Het
Myo7b T A 18: 31,983,944 T908S probably benign Het
Nbeal2 T G 9: 110,643,808 probably benign Het
Nwd2 T G 5: 63,800,414 F362L probably benign Het
Pcm1 A T 8: 41,261,020 R208W probably damaging Het
Pkd2l1 T C 19: 44,150,470 D647G probably benign Het
Plbd1 C T 6: 136,641,147 V24M probably damaging Het
Polr2a G A 11: 69,735,117 P1698S unknown Het
Prss12 T C 3: 123,485,504 I410T probably damaging Het
Ptpre A G 7: 135,679,235 N565S probably damaging Het
Rab44 T C 17: 29,145,270 L606P unknown Het
Rbm10 C T X: 20,637,664 probably benign Het
Rhd C T 4: 134,876,301 probably benign Het
Rspo3 T A 10: 29,499,921 probably benign Het
Sdccag8 T A 1: 176,946,144 N555K probably benign Het
Skint6 T A 4: 112,865,651 probably benign Het
Slc22a20 G A 19: 5,986,008 P45S probably damaging Het
Slc5a2 A G 7: 128,267,482 Y124C probably damaging Het
Spats2l T C 1: 57,885,884 L127P possibly damaging Het
Taar8a T A 10: 24,077,077 I193N probably benign Het
Ten1 C T 11: 116,216,684 probably benign Het
Tfb2m T C 1: 179,545,833 E100G probably damaging Het
Tom1 C T 8: 75,052,306 probably benign Het
Vps52 G T 17: 33,960,011 R171L probably damaging Het
Zcwpw2 A T 9: 118,014,114 noncoding transcript Het
Zfhx4 G A 3: 5,403,820 E3013K probably damaging Het
Other mutations in Zfp777
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01530:Zfp777 APN 6 48043984 missense probably damaging 1.00
IGL01916:Zfp777 APN 6 48025342 missense probably damaging 1.00
IGL01959:Zfp777 APN 6 48044341 missense probably benign
IGL02167:Zfp777 APN 6 48044526 missense probably damaging 0.98
IGL03150:Zfp777 APN 6 48044125 missense probably damaging 1.00
R0238:Zfp777 UTSW 6 48024969 missense probably damaging 0.99
R0238:Zfp777 UTSW 6 48024969 missense probably damaging 0.99
R0372:Zfp777 UTSW 6 48044476 missense possibly damaging 0.62
R1300:Zfp777 UTSW 6 48025770 missense probably benign 0.43
R1727:Zfp777 UTSW 6 48043890 missense probably damaging 0.99
R1906:Zfp777 UTSW 6 48042061 missense probably damaging 0.99
R2047:Zfp777 UTSW 6 48044346 missense probably benign
R2097:Zfp777 UTSW 6 48044242 missense probably benign 0.08
R2211:Zfp777 UTSW 6 48043885 missense possibly damaging 0.79
R2898:Zfp777 UTSW 6 48025660 missense probably damaging 0.97
R3123:Zfp777 UTSW 6 48029116 unclassified probably benign
R3832:Zfp777 UTSW 6 48044215 missense probably benign 0.00
R4019:Zfp777 UTSW 6 48042112 missense probably damaging 1.00
R4077:Zfp777 UTSW 6 48025522 missense probably benign
R4471:Zfp777 UTSW 6 48042107 missense probably damaging 1.00
R5021:Zfp777 UTSW 6 48042127 missense probably damaging 0.99
R5030:Zfp777 UTSW 6 48037667 missense probably damaging 0.99
R5819:Zfp777 UTSW 6 48037588 missense probably damaging 0.99
R6544:Zfp777 UTSW 6 48044485 missense probably damaging 0.98
R6736:Zfp777 UTSW 6 48024856 missense probably damaging 0.99
R6971:Zfp777 UTSW 6 48024691 missense probably damaging 1.00
R7240:Zfp777 UTSW 6 48044449 missense probably benign 0.00
R7258:Zfp777 UTSW 6 48025797 missense probably damaging 0.99
R7586:Zfp777 UTSW 6 48029218 missense probably benign 0.33
R7833:Zfp777 UTSW 6 48025138 missense probably damaging 0.99
R7916:Zfp777 UTSW 6 48025138 missense probably damaging 0.99
RF008:Zfp777 UTSW 6 48042048 nonsense probably null
Z1177:Zfp777 UTSW 6 48025234 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAACTTACCCGTGCAGTTTCTCTG -3'
(R):5'- TTTGACTCCCTGGCGTGGAAAG -3'

Sequencing Primer
(F):5'- AGCTCACTGAACTCGCTG -3'
(R):5'- GCATTCAAGACTACTACGAAGTGTC -3'
Posted On2013-09-30