Incidental Mutation 'R0762:Gars'
ID72447
Institutional Source Beutler Lab
Gene Symbol Gars
Ensembl Gene ENSMUSG00000029777
Gene Nameglycyl-tRNA synthetase
SynonymsGENA202, Sgrp23, Gena201
MMRRC Submission 038942-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0762 (G1)
Quality Score218
Status Validated
Chromosome6
Chromosomal Location55038007-55079500 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to G at 55077580 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000003572 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003572]
Predicted Effect probably null
Transcript: ENSMUST00000003572
SMART Domains Protein: ENSMUSP00000003572
Gene: ENSMUSG00000029777

DomainStartEndE-ValueType
low complexity region 4 27 N/A INTRINSIC
low complexity region 31 46 N/A INTRINSIC
WHEP-TRS 57 112 1.58e-8 SMART
Pfam:tRNA-synt_2b 281 582 2.1e-10 PFAM
Pfam:HGTP_anticodon 605 699 7.7e-24 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 93.9%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes glycyl-tRNA synthetase, one of the aminoacyl-tRNA synthetases that charge tRNAs with their cognate amino acids. The encoded enzyme is an (alpha)2 dimer which belongs to the class II family of tRNA synthetases. It has been shown to be a target of autoantibodies in the human autoimmune diseases, polymyositis or dermatomyositis. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2015]
PHENOTYPE: A dominant mutation results in sensory and motor axon degeneration in affected mice, with defects in synaptic transmission, nerve conduction and premature death. A loss of function mutation results in embryonic lethality in homozygous mice, and no discernable phenotype in heterozygous mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik A G 15: 8,218,416 probably benign Het
4921504E06Rik T A 2: 19,477,856 N475I probably damaging Het
Adar T C 3: 89,739,983 probably benign Het
Aldh3b3 A T 19: 3,965,747 probably null Het
Amtn C T 5: 88,385,000 T158I possibly damaging Het
Ap1g2 A G 14: 55,100,411 probably benign Het
Arhgef3 A G 14: 27,397,627 Y318C probably damaging Het
Atg2b A C 12: 105,674,970 V69G possibly damaging Het
Bbx G A 16: 50,225,166 T236I possibly damaging Het
Bcl11b C T 12: 107,965,663 probably benign Het
Catsperg1 T C 7: 29,189,952 I794V probably benign Het
Ccdc88a C T 11: 29,463,112 probably benign Het
Cdhr3 C A 12: 33,060,301 R328L probably benign Het
Ces2e T A 8: 104,929,864 M242K probably damaging Het
Col12a1 A G 9: 79,681,374 probably benign Het
Col3a1 T C 1: 45,321,526 S39P unknown Het
Cyp2a5 T A 7: 26,838,873 Y220* probably null Het
D3Ertd254e G A 3: 36,165,867 D680N possibly damaging Het
Dcc T A 18: 71,342,705 probably benign Het
Dnajb8 A G 6: 88,223,054 T191A probably damaging Het
Ephx2 A T 14: 66,102,179 F199I probably damaging Het
Fancd2 A G 6: 113,574,658 K1062E probably benign Het
Fbxo33 A G 12: 59,204,499 V410A probably benign Het
Git1 A C 11: 77,499,834 D132A possibly damaging Het
Gm853 A G 4: 130,221,624 S44P probably damaging Het
Gp1ba C T 11: 70,641,427 P673L probably damaging Het
Gucy1a1 T C 3: 82,094,896 T44A unknown Het
Hjurp G C 1: 88,277,215 probably benign Het
Ifnlr1 A G 4: 135,701,329 K156E possibly damaging Het
Klf13 T C 7: 63,891,623 N15S probably benign Het
Krt77 T C 15: 101,861,126 probably null Het
Map4 C A 9: 110,038,478 probably benign Het
Mthfr T C 4: 148,055,443 I623T possibly damaging Het
Myo7b T A 18: 31,983,944 T908S probably benign Het
Nbeal2 T G 9: 110,643,808 probably benign Het
Nwd2 T G 5: 63,800,414 F362L probably benign Het
Pcm1 A T 8: 41,261,020 R208W probably damaging Het
Pkd2l1 T C 19: 44,150,470 D647G probably benign Het
Plbd1 C T 6: 136,641,147 V24M probably damaging Het
Polr2a G A 11: 69,735,117 P1698S unknown Het
Prss12 T C 3: 123,485,504 I410T probably damaging Het
Ptpre A G 7: 135,679,235 N565S probably damaging Het
Rab44 T C 17: 29,145,270 L606P unknown Het
Rbm10 C T X: 20,637,664 probably benign Het
Rhd C T 4: 134,876,301 probably benign Het
Rspo3 T A 10: 29,499,921 probably benign Het
Sdccag8 T A 1: 176,946,144 N555K probably benign Het
Skint6 T A 4: 112,865,651 probably benign Het
Slc22a20 G A 19: 5,986,008 P45S probably damaging Het
Slc5a2 A G 7: 128,267,482 Y124C probably damaging Het
Spats2l T C 1: 57,885,884 L127P possibly damaging Het
Taar8a T A 10: 24,077,077 I193N probably benign Het
Ten1 C T 11: 116,216,684 probably benign Het
Tfb2m T C 1: 179,545,833 E100G probably damaging Het
Tom1 C T 8: 75,052,306 probably benign Het
Vps52 G T 17: 33,960,011 R171L probably damaging Het
Zcwpw2 A T 9: 118,014,114 noncoding transcript Het
Zfhx4 G A 3: 5,403,820 E3013K probably damaging Het
Zfp777 C T 6: 48,029,360 V411M probably damaging Het
Other mutations in Gars
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00818:Gars APN 6 55050353 missense probably damaging 1.00
IGL01084:Gars APN 6 55055827 missense probably benign
IGL01514:Gars APN 6 55065520 missense probably benign 0.01
IGL02104:Gars APN 6 55077697 missense probably damaging 1.00
IGL02349:Gars APN 6 55048064 splice site probably benign
IGL02371:Gars APN 6 55065467 missense probably benign 0.08
IGL02932:Gars APN 6 55060944 missense probably damaging 1.00
IGL02799:Gars UTSW 6 55063099 missense probably damaging 1.00
R0637:Gars UTSW 6 55069487 critical splice donor site probably null
R1451:Gars UTSW 6 55053123 splice site probably benign
R1846:Gars UTSW 6 55063168 missense probably benign 0.05
R1988:Gars UTSW 6 55077772 missense probably null 0.00
R2033:Gars UTSW 6 55077723 missense probably benign 0.02
R2566:Gars UTSW 6 55065563 missense probably damaging 1.00
R4706:Gars UTSW 6 55069378 missense probably damaging 0.99
R4854:Gars UTSW 6 55046418 missense probably damaging 0.99
R5055:Gars UTSW 6 55068092 missense probably damaging 1.00
R5558:Gars UTSW 6 55065607 missense probably damaging 1.00
R6306:Gars UTSW 6 55055824 missense probably damaging 1.00
R6821:Gars UTSW 6 55079338 missense probably benign 0.00
R7376:Gars UTSW 6 55073359 missense probably benign 0.00
R7505:Gars UTSW 6 55052177 missense probably benign 0.00
R7579:Gars UTSW 6 55077703 missense probably damaging 1.00
R7605:Gars UTSW 6 55077750 missense probably damaging 1.00
R7728:Gars UTSW 6 55050386 missense probably damaging 1.00
R8014:Gars UTSW 6 55073407 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCCCTTTACTTCTGCATGAGCAGC -3'
(R):5'- AAGGCAGTCACCTCTGCCCTTATC -3'

Sequencing Primer
(F):5'- TGCATGAGCAGCTCAGG -3'
(R):5'- GCCCTTATCTGTCTCATGGAG -3'
Posted On2013-09-30