Incidental Mutation 'R9614:Scel'
ID 724472
Institutional Source Beutler Lab
Gene Symbol Scel
Ensembl Gene ENSMUSG00000022123
Gene Name sciellin
Synonyms 9230114I02Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9614 (G1)
Quality Score 225.009
Status Not validated
Chromosome 14
Chromosomal Location 103513342-103612797 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 103605596 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Aspartic acid at position 558 (G558D)
Ref Sequence ENSEMBL: ENSMUSP00000093233 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095576] [ENSMUST00000227322]
AlphaFold Q9EQG3
Predicted Effect probably damaging
Transcript: ENSMUST00000095576
AA Change: G558D

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000093233
Gene: ENSMUSG00000022123
AA Change: G558D

DomainStartEndE-ValueType
low complexity region 111 131 N/A INTRINSIC
low complexity region 159 178 N/A INTRINSIC
internal_repeat_1 204 327 9.24e-7 PROSPERO
internal_repeat_1 378 505 9.24e-7 PROSPERO
low complexity region 525 537 N/A INTRINSIC
LIM 584 642 2.23e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000227322
AA Change: G538D

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a precursor to the cornified envelope of terminally differentiated keratinocytes. This protein localizes to the periphery of cells and may function in the assembly or regulation of proteins in the cornified envelope. Transcript variants encoding different isoforms exist. A transcript variant utilizing an alternative polyA signal has been described in the literature, but its full-length nature has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are viable and fertile with normal hair morphology and development and normal skin morphology and barrier function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810055G02Rik C T 19: 3,717,364 T317I possibly damaging Het
Adamts7 T A 9: 90,195,198 V1306E probably damaging Het
Adcy9 C T 16: 4,288,683 D1093N probably damaging Het
Adgra3 A G 5: 50,006,908 V243A probably damaging Het
Aqp4 C T 18: 15,393,630 A265T probably benign Het
Atad2 A T 15: 58,106,723 probably null Het
Atp13a4 A G 16: 29,441,580 V560A Het
Best2 A C 8: 85,013,422 C38G Het
Bicra A T 7: 15,971,955 S1520R probably damaging Het
C1s2 A G 6: 124,625,629 L541P probably damaging Het
Calcoco2 T A 11: 96,100,359 H184L probably benign Het
Cav1 A T 6: 17,339,404 I163F probably benign Het
Ccdc151 T C 9: 21,993,014 D322G probably benign Het
Cep57l1 T C 10: 41,721,567 H356R probably damaging Het
Clu A C 14: 65,971,402 H32P unknown Het
Col5a1 T A 2: 27,989,174 D840E unknown Het
Cramp1l C A 17: 24,982,809 K566N probably damaging Het
Csmd1 C A 8: 16,158,225 V1239L probably benign Het
Cubn T A 2: 13,478,134 Q267L probably benign Het
Cul7 C T 17: 46,664,286 R1689W probably damaging Het
Dao A T 5: 114,013,999 D126V probably benign Het
Eif3l T C 15: 79,094,223 M560T probably benign Het
F830016B08Rik T A 18: 60,300,307 I154N probably damaging Het
Fam184a T C 10: 53,641,048 E980G probably damaging Het
Fgf21 T C 7: 45,615,279 T10A probably benign Het
Fhad1 A C 4: 141,951,571 V598G possibly damaging Het
Foxc1 A T 13: 31,807,880 I225F possibly damaging Het
Foxo3 C T 10: 42,197,025 V499M probably damaging Het
Galnt9 G A 5: 110,596,181 G294S probably damaging Het
Gp5 A C 16: 30,309,575 F94V probably damaging Het
Idh2 A T 7: 80,098,177 Y258* probably null Het
Immp2l T C 12: 41,110,934 V77A probably damaging Het
Isl1 T C 13: 116,305,388 E103G Het
Itgad A T 7: 128,203,850 T1059S probably damaging Het
Kcnj6 G A 16: 94,832,448 T268I probably damaging Het
Lgals3bp A G 11: 118,393,211 V514A probably benign Het
Mcfd2 A T 17: 87,257,993 H27Q probably benign Het
Mettl13 A G 1: 162,537,200 W537R probably damaging Het
Mybl2 G T 2: 163,064,305 G102V probably damaging Het
Nars2 C T 7: 97,039,918 T349M probably damaging Het
Nat8f3 A T 6: 85,761,726 V18E Het
Npepps T C 11: 97,258,351 E115G probably benign Het
Olfr1057 A G 2: 86,374,668 V248A probably damaging Het
Olfr1382 T A 11: 49,535,244 W20R probably damaging Het
Olfr834 A T 9: 18,988,230 M81L possibly damaging Het
Olfr926 G A 9: 38,877,985 V270M probably damaging Het
Oog2 T A 4: 144,196,137 V324E probably damaging Het
Pdzd2 A G 15: 12,375,400 S1550P probably damaging Het
Peg10 T TCCC 6: 4,756,451 probably benign Het
Pms2 T C 5: 143,917,602 V243A probably benign Het
Ptpn9 A G 9: 57,036,721 D293G probably benign Het
Ptprb A G 10: 116,367,536 K1784R probably damaging Het
Rab23 CAA CA 1: 33,724,996 probably null Het
Raf1 T C 6: 115,619,636 N576D probably benign Het
Rasa4 C A 5: 136,111,489 H782Q possibly damaging Het
Rims1 C A 1: 22,421,745 E168* probably null Het
Rpgrip1l A T 8: 91,260,806 N874K possibly damaging Het
Rxfp4 C T 3: 88,652,662 V161I possibly damaging Het
Sipa1l2 T C 8: 125,469,826 K723R probably null Het
Slc12a1 A T 2: 125,160,525 R142W probably damaging Het
Slc27a2 T A 2: 126,567,816 V306D probably damaging Het
Sox4 C T 13: 28,952,096 G309D probably damaging Het
Terb1 T C 8: 104,496,844 T111A probably benign Het
Tgfa G A 6: 86,271,415 R133H probably damaging Het
Ticrr T C 7: 79,696,006 S1836P probably damaging Het
Tlk2 A G 11: 105,247,502 D292G probably benign Het
Tmc7 A G 7: 118,541,937 I657T probably benign Het
Tmprss11c G A 5: 86,235,520 T349I probably benign Het
Trhr A G 15: 44,197,585 N167S probably benign Het
Tsc22d1 T G 14: 76,416,543 I154S probably damaging Het
Vmn1r2 T C 4: 3,172,587 Y169H probably damaging Het
Vmn1r77 G T 7: 12,041,839 V181L probably benign Het
Other mutations in Scel
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00841:Scel APN 14 103529995 missense probably benign 0.01
IGL00913:Scel APN 14 103581809 missense probably benign 0.35
IGL01086:Scel APN 14 103612391 missense probably benign 0.05
IGL01352:Scel APN 14 103533338 missense possibly damaging 0.54
IGL01396:Scel APN 14 103608094 splice site probably benign
IGL01954:Scel APN 14 103603242 splice site probably benign
IGL02064:Scel APN 14 103533326 missense probably damaging 0.98
IGL02186:Scel APN 14 103564821 missense probably benign 0.23
IGL02475:Scel APN 14 103537008 missense possibly damaging 0.95
IGL02926:Scel APN 14 103576247 nonsense probably null
IGL03122:Scel APN 14 103599406 missense possibly damaging 0.66
IGL03135:Scel APN 14 103586514 missense probably benign 0.02
PIT4585001:Scel UTSW 14 103592368 missense possibly damaging 0.90
R0346:Scel UTSW 14 103529984 missense probably damaging 1.00
R0394:Scel UTSW 14 103562518 missense probably benign 0.15
R0418:Scel UTSW 14 103603254 missense probably benign
R0635:Scel UTSW 14 103583139 critical splice donor site probably null
R0815:Scel UTSW 14 103586480 missense possibly damaging 0.83
R0863:Scel UTSW 14 103586480 missense possibly damaging 0.83
R0990:Scel UTSW 14 103581832 missense possibly damaging 0.55
R1084:Scel UTSW 14 103564843 critical splice donor site probably null
R1641:Scel UTSW 14 103533316 missense probably damaging 1.00
R2001:Scel UTSW 14 103610790 missense possibly damaging 0.66
R2002:Scel UTSW 14 103541985 missense probably damaging 1.00
R2341:Scel UTSW 14 103608170 missense possibly damaging 0.92
R3425:Scel UTSW 14 103608106 missense possibly damaging 0.92
R3836:Scel UTSW 14 103592386 missense possibly damaging 0.66
R4035:Scel UTSW 14 103530004 missense probably damaging 1.00
R4197:Scel UTSW 14 103599400 missense probably damaging 0.97
R4737:Scel UTSW 14 103572037 missense possibly damaging 0.79
R4801:Scel UTSW 14 103583100 missense probably benign 0.01
R4802:Scel UTSW 14 103583100 missense probably benign 0.01
R5369:Scel UTSW 14 103586493 missense probably benign 0.00
R5555:Scel UTSW 14 103602206 missense probably benign 0.27
R5582:Scel UTSW 14 103583139 critical splice donor site probably benign
R5931:Scel UTSW 14 103605624 nonsense probably null
R5978:Scel UTSW 14 103529254 splice site probably null
R6045:Scel UTSW 14 103592213 missense probably benign 0.12
R6062:Scel UTSW 14 103585136 missense possibly damaging 0.82
R6218:Scel UTSW 14 103572042 missense probably benign 0.12
R6225:Scel UTSW 14 103591984 missense probably benign 0.27
R7102:Scel UTSW 14 103543832 nonsense probably null
R7349:Scel UTSW 14 103543879 missense probably benign 0.11
R8376:Scel UTSW 14 103572015 missense probably benign 0.02
R8924:Scel UTSW 14 103592371 missense possibly damaging 0.66
R9014:Scel UTSW 14 103585139 missense probably benign
R9130:Scel UTSW 14 103533310 missense probably benign 0.05
R9135:Scel UTSW 14 103602190 missense probably benign
R9179:Scel UTSW 14 103574400 missense possibly damaging 0.79
R9638:Scel UTSW 14 103541973 missense possibly damaging 0.89
R9672:Scel UTSW 14 103599402 missense possibly damaging 0.82
R9719:Scel UTSW 14 103572006 critical splice acceptor site probably null
X0026:Scel UTSW 14 103591993 missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- ACATGTTGACTTGCTGGGGC -3'
(R):5'- ACTGCACGATGGTCTCTTTG -3'

Sequencing Primer
(F):5'- GGCTTTTTGTGTCATTACTTCTACAG -3'
(R):5'- GCACGATGGTCTCTTTGTACTTATC -3'
Posted On 2022-09-12