Mutagenetix > Incidental Mutation

Incidental Mutation 'R9614:Scel'

724472

Institutional Source

Beutler Lab

Gene Symbol

Scel

Ensembl Gene

ENSMUSG00000022123

Gene Name

sciellin

Synonyms

9230114I02Rik

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9614 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

103513342-103612797 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 103605596 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Aspartic acid at position 558 (G558D)

Ref Sequence

ENSEMBL: ENSMUSP00000093233 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000095576] [ENSMUST00000227322]

AlphaFold

Q9EQG3

Predicted Effect

probably damaging
Transcript: ENSMUST00000095576
AA Change: G558D

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000093233
Gene: ENSMUSG00000022123
AA Change: G558D

Domain	Start	End	E-Value	Type
low complexity region	111	131	N/A	INTRINSIC
low complexity region	159	178	N/A	INTRINSIC
internal_repeat_1	204	327	9.24e-7	PROSPERO
internal_repeat_1	378	505	9.24e-7	PROSPERO
low complexity region	525	537	N/A	INTRINSIC
LIM	584	642	2.23e-3	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000227322
AA Change: G538D

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a precursor to the cornified envelope of terminally differentiated keratinocytes. This protein localizes to the periphery of cells and may function in the assembly or regulation of proteins in the cornified envelope. Transcript variants encoding different isoforms exist. A transcript variant utilizing an alternative polyA signal has been described in the literature, but its full-length nature has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are viable and fertile with normal hair morphology and development and normal skin morphology and barrier function. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810055G02Rik	C	T	19: 3,717,364	T317I	possibly damaging	Het
Adamts7	T	A	9: 90,195,198	V1306E	probably damaging	Het
Adcy9	C	T	16: 4,288,683	D1093N	probably damaging	Het
Adgra3	A	G	5: 50,006,908	V243A	probably damaging	Het
Aqp4	C	T	18: 15,393,630	A265T	probably benign	Het
Atad2	A	T	15: 58,106,723		probably null	Het
Atp13a4	A	G	16: 29,441,580	V560A		Het
Best2	A	C	8: 85,013,422	C38G		Het
Bicra	A	T	7: 15,971,955	S1520R	probably damaging	Het
C1s2	A	G	6: 124,625,629	L541P	probably damaging	Het
Calcoco2	T	A	11: 96,100,359	H184L	probably benign	Het
Cav1	A	T	6: 17,339,404	I163F	probably benign	Het
Ccdc151	T	C	9: 21,993,014	D322G	probably benign	Het
Cep57l1	T	C	10: 41,721,567	H356R	probably damaging	Het
Clu	A	C	14: 65,971,402	H32P	unknown	Het
Col5a1	T	A	2: 27,989,174	D840E	unknown	Het
Cramp1l	C	A	17: 24,982,809	K566N	probably damaging	Het
Csmd1	C	A	8: 16,158,225	V1239L	probably benign	Het
Cubn	T	A	2: 13,478,134	Q267L	probably benign	Het
Cul7	C	T	17: 46,664,286	R1689W	probably damaging	Het
Dao	A	T	5: 114,013,999	D126V	probably benign	Het
Eif3l	T	C	15: 79,094,223	M560T	probably benign	Het
F830016B08Rik	T	A	18: 60,300,307	I154N	probably damaging	Het
Fam184a	T	C	10: 53,641,048	E980G	probably damaging	Het
Fgf21	T	C	7: 45,615,279	T10A	probably benign	Het
Fhad1	A	C	4: 141,951,571	V598G	possibly damaging	Het
Foxc1	A	T	13: 31,807,880	I225F	possibly damaging	Het
Foxo3	C	T	10: 42,197,025	V499M	probably damaging	Het
Galnt9	G	A	5: 110,596,181	G294S	probably damaging	Het
Gp5	A	C	16: 30,309,575	F94V	probably damaging	Het
Idh2	A	T	7: 80,098,177	Y258*	probably null	Het
Immp2l	T	C	12: 41,110,934	V77A	probably damaging	Het
Isl1	T	C	13: 116,305,388	E103G		Het
Itgad	A	T	7: 128,203,850	T1059S	probably damaging	Het
Kcnj6	G	A	16: 94,832,448	T268I	probably damaging	Het
Lgals3bp	A	G	11: 118,393,211	V514A	probably benign	Het
Mcfd2	A	T	17: 87,257,993	H27Q	probably benign	Het
Mettl13	A	G	1: 162,537,200	W537R	probably damaging	Het
Mybl2	G	T	2: 163,064,305	G102V	probably damaging	Het
Nars2	C	T	7: 97,039,918	T349M	probably damaging	Het
Nat8f3	A	T	6: 85,761,726	V18E		Het
Npepps	T	C	11: 97,258,351	E115G	probably benign	Het
Olfr1057	A	G	2: 86,374,668	V248A	probably damaging	Het
Olfr1382	T	A	11: 49,535,244	W20R	probably damaging	Het
Olfr834	A	T	9: 18,988,230	M81L	possibly damaging	Het
Olfr926	G	A	9: 38,877,985	V270M	probably damaging	Het
Oog2	T	A	4: 144,196,137	V324E	probably damaging	Het
Pdzd2	A	G	15: 12,375,400	S1550P	probably damaging	Het
Peg10	T	TCCC	6: 4,756,451		probably benign	Het
Pms2	T	C	5: 143,917,602	V243A	probably benign	Het
Ptpn9	A	G	9: 57,036,721	D293G	probably benign	Het
Ptprb	A	G	10: 116,367,536	K1784R	probably damaging	Het
Rab23	CAA	CA	1: 33,724,996		probably null	Het
Raf1	T	C	6: 115,619,636	N576D	probably benign	Het
Rasa4	C	A	5: 136,111,489	H782Q	possibly damaging	Het
Rims1	C	A	1: 22,421,745	E168*	probably null	Het
Rpgrip1l	A	T	8: 91,260,806	N874K	possibly damaging	Het
Rxfp4	C	T	3: 88,652,662	V161I	possibly damaging	Het
Sipa1l2	T	C	8: 125,469,826	K723R	probably null	Het
Slc12a1	A	T	2: 125,160,525	R142W	probably damaging	Het
Slc27a2	T	A	2: 126,567,816	V306D	probably damaging	Het
Sox4	C	T	13: 28,952,096	G309D	probably damaging	Het
Terb1	T	C	8: 104,496,844	T111A	probably benign	Het
Tgfa	G	A	6: 86,271,415	R133H	probably damaging	Het
Ticrr	T	C	7: 79,696,006	S1836P	probably damaging	Het
Tlk2	A	G	11: 105,247,502	D292G	probably benign	Het
Tmc7	A	G	7: 118,541,937	I657T	probably benign	Het
Tmprss11c	G	A	5: 86,235,520	T349I	probably benign	Het
Trhr	A	G	15: 44,197,585	N167S	probably benign	Het
Tsc22d1	T	G	14: 76,416,543	I154S	probably damaging	Het
Vmn1r2	T	C	4: 3,172,587	Y169H	probably damaging	Het
Vmn1r77	G	T	7: 12,041,839	V181L	probably benign	Het

Other mutations in Scel

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00841:Scel	APN	14	103529995	missense	probably benign	0.01
IGL00913:Scel	APN	14	103581809	missense	probably benign	0.35
IGL01086:Scel	APN	14	103612391	missense	probably benign	0.05
IGL01352:Scel	APN	14	103533338	missense	possibly damaging	0.54
IGL01396:Scel	APN	14	103608094	splice site	probably benign
IGL01954:Scel	APN	14	103603242	splice site	probably benign
IGL02064:Scel	APN	14	103533326	missense	probably damaging	0.98
IGL02186:Scel	APN	14	103564821	missense	probably benign	0.23
IGL02475:Scel	APN	14	103537008	missense	possibly damaging	0.95
IGL02926:Scel	APN	14	103576247	nonsense	probably null
IGL03122:Scel	APN	14	103599406	missense	possibly damaging	0.66
IGL03135:Scel	APN	14	103586514	missense	probably benign	0.02
PIT4585001:Scel	UTSW	14	103592368	missense	possibly damaging	0.90
R0346:Scel	UTSW	14	103529984	missense	probably damaging	1.00
R0394:Scel	UTSW	14	103562518	missense	probably benign	0.15
R0418:Scel	UTSW	14	103603254	missense	probably benign
R0635:Scel	UTSW	14	103583139	critical splice donor site	probably null
R0815:Scel	UTSW	14	103586480	missense	possibly damaging	0.83
R0863:Scel	UTSW	14	103586480	missense	possibly damaging	0.83
R0990:Scel	UTSW	14	103581832	missense	possibly damaging	0.55
R1084:Scel	UTSW	14	103564843	critical splice donor site	probably null
R1641:Scel	UTSW	14	103533316	missense	probably damaging	1.00
R2001:Scel	UTSW	14	103610790	missense	possibly damaging	0.66
R2002:Scel	UTSW	14	103541985	missense	probably damaging	1.00
R2341:Scel	UTSW	14	103608170	missense	possibly damaging	0.92
R3425:Scel	UTSW	14	103608106	missense	possibly damaging	0.92
R3836:Scel	UTSW	14	103592386	missense	possibly damaging	0.66
R4035:Scel	UTSW	14	103530004	missense	probably damaging	1.00
R4197:Scel	UTSW	14	103599400	missense	probably damaging	0.97
R4737:Scel	UTSW	14	103572037	missense	possibly damaging	0.79
R4801:Scel	UTSW	14	103583100	missense	probably benign	0.01
R4802:Scel	UTSW	14	103583100	missense	probably benign	0.01
R5369:Scel	UTSW	14	103586493	missense	probably benign	0.00
R5555:Scel	UTSW	14	103602206	missense	probably benign	0.27
R5582:Scel	UTSW	14	103583139	critical splice donor site	probably benign
R5931:Scel	UTSW	14	103605624	nonsense	probably null
R5978:Scel	UTSW	14	103529254	splice site	probably null
R6045:Scel	UTSW	14	103592213	missense	probably benign	0.12
R6062:Scel	UTSW	14	103585136	missense	possibly damaging	0.82
R6218:Scel	UTSW	14	103572042	missense	probably benign	0.12
R6225:Scel	UTSW	14	103591984	missense	probably benign	0.27
R7102:Scel	UTSW	14	103543832	nonsense	probably null
R7349:Scel	UTSW	14	103543879	missense	probably benign	0.11
R8376:Scel	UTSW	14	103572015	missense	probably benign	0.02
R8924:Scel	UTSW	14	103592371	missense	possibly damaging	0.66
R9014:Scel	UTSW	14	103585139	missense	probably benign
R9130:Scel	UTSW	14	103533310	missense	probably benign	0.05
R9135:Scel	UTSW	14	103602190	missense	probably benign
R9179:Scel	UTSW	14	103574400	missense	possibly damaging	0.79
R9638:Scel	UTSW	14	103541973	missense	possibly damaging	0.89
R9672:Scel	UTSW	14	103599402	missense	possibly damaging	0.82
R9719:Scel	UTSW	14	103572006	critical splice acceptor site	probably null
X0026:Scel	UTSW	14	103591993	missense	possibly damaging	0.46

Predicted Primers

PCR Primer
(F):5'- ACATGTTGACTTGCTGGGGC -3'
(R):5'- ACTGCACGATGGTCTCTTTG -3'

Sequencing Primer
(F):5'- GGCTTTTTGTGTCATTACTTCTACAG -3'
(R):5'- GCACGATGGTCTCTTTGTACTTATC -3'

Posted On

2022-09-12