Incidental Mutation 'R9615:Abca16'
ID 724512
Institutional Source Beutler Lab
Gene Symbol Abca16
Ensembl Gene ENSMUSG00000051900
Gene Name ATP-binding cassette, sub-family A member 16
Synonyms
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9615 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 120008870-120144036 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 120126404 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 1188 (F1188I)
Ref Sequence ENSEMBL: ENSMUSP00000112736 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056042] [ENSMUST00000120490]
AlphaFold E9PWJ7
Predicted Effect probably benign
Transcript: ENSMUST00000056042
AA Change: F1187I

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000061094
Gene: ENSMUSG00000051900
AA Change: F1187I

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 26 455 2.7e-23 PFAM
AAA 537 720 2.01e-7 SMART
Pfam:ABC2_membrane_3 898 1287 4.6e-25 PFAM
low complexity region 1325 1336 N/A INTRINSIC
low complexity region 1342 1353 N/A INTRINSIC
AAA 1378 1563 4.23e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120490
AA Change: F1188I

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000112736
Gene: ENSMUSG00000051900
AA Change: F1188I

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 25 456 2.4e-22 PFAM
AAA 538 721 2.01e-7 SMART
Pfam:ABC2_membrane_3 899 1288 1.1e-27 PFAM
low complexity region 1326 1337 N/A INTRINSIC
low complexity region 1343 1354 N/A INTRINSIC
AAA 1379 1564 4.23e-6 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI

All alleles(4) : Targeted(3) Gene trapped(1

Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123K08Rik T C 5: 138,561,814 (GRCm39) Q124R probably damaging Het
Acat3 G A 17: 13,147,502 (GRCm39) Q172* probably null Het
Aicda T A 6: 122,538,113 (GRCm39) C90* probably null Het
Arhgap39 C A 15: 76,621,438 (GRCm39) V388L probably benign Het
B020011L13Rik A T 1: 117,729,462 (GRCm39) H323L probably damaging Het
Bsn C T 9: 107,984,430 (GRCm39) R436Q Het
C3 A T 17: 57,518,669 (GRCm39) L1238Q probably damaging Het
Cert1 C T 13: 96,767,334 (GRCm39) H495Y possibly damaging Het
Ces1g A G 8: 94,061,807 (GRCm39) V33A probably damaging Het
Clstn1 A G 4: 149,722,757 (GRCm39) D475G probably damaging Het
Cmtm2a A G 8: 105,019,286 (GRCm39) V101A probably damaging Het
Cnnm4 A G 1: 36,511,893 (GRCm39) M374V probably damaging Het
Commd9 T C 2: 101,727,436 (GRCm39) S77P possibly damaging Het
Cox7a2l A G 17: 83,821,701 (GRCm39) Y2H possibly damaging Het
Cramp1 C A 17: 25,201,783 (GRCm39) K566N probably damaging Het
Cubn G A 2: 13,325,991 (GRCm39) H2725Y possibly damaging Het
Cyp2c39 T C 19: 39,501,617 (GRCm39) F57L probably benign Het
Dgkh A T 14: 78,813,370 (GRCm39) V1036D possibly damaging Het
Dip2c G A 13: 9,625,191 (GRCm39) V562I probably benign Het
Fat3 T C 9: 16,289,343 (GRCm39) Q60R probably benign Het
Gm1527 A G 3: 28,969,475 (GRCm39) D275G probably damaging Het
Gp5 A C 16: 30,128,393 (GRCm39) F94V probably damaging Het
Grik4 T A 9: 42,502,765 (GRCm39) K453* probably null Het
Hdlbp T C 1: 93,358,014 (GRCm39) T296A probably benign Het
Hrh4 C A 18: 13,154,944 (GRCm39) T161K probably benign Het
Ift74 A T 4: 94,550,822 (GRCm39) probably null Het
Kctd5 A T 17: 24,292,192 (GRCm39) Y71N probably benign Het
Klhl42 T C 6: 147,009,373 (GRCm39) L404P probably damaging Het
Klra5 C A 6: 129,883,686 (GRCm39) W147L possibly damaging Het
Lipe T A 7: 25,097,326 (GRCm39) K206* probably null Het
Lipo3 T C 19: 33,754,047 (GRCm39) I363V probably benign Het
Mrgpra6 T A 7: 46,835,675 (GRCm39) I249F probably benign Het
Myo15a A T 11: 60,374,320 (GRCm39) N125I Het
Nbr1 T A 11: 101,465,978 (GRCm39) I753N probably benign Het
Ndor1 T C 2: 25,138,434 (GRCm39) D451G probably benign Het
Nlrp5 C T 7: 23,107,561 (GRCm39) T78I probably benign Het
Or10j3b A T 1: 173,044,034 (GRCm39) E272V possibly damaging Het
Or51ag1 C T 7: 103,155,727 (GRCm39) R142H probably benign Het
Prom1 A G 5: 44,164,399 (GRCm39) F728S probably damaging Het
Ptgs2 T A 1: 149,980,802 (GRCm39) F456Y probably damaging Het
Rtl1 G A 12: 109,556,835 (GRCm39) A1668V possibly damaging Het
Runx2 A T 17: 44,969,560 (GRCm39) D310E probably benign Het
Samd4b A T 7: 28,106,714 (GRCm39) I349K probably damaging Het
Scn10a A G 9: 119,487,504 (GRCm39) M610T possibly damaging Het
Sec61b A G 4: 47,483,056 (GRCm39) I105V probably benign Het
Semp2l2b T C 10: 21,943,611 (GRCm39) E123G probably benign Het
Slc35f4 A G 14: 49,556,306 (GRCm39) V149A probably benign Het
Smndc1 T A 19: 53,368,951 (GRCm39) M221L probably damaging Het
Ssh2 A G 11: 77,316,203 (GRCm39) N275D possibly damaging Het
Tas2r124 C T 6: 132,732,492 (GRCm39) T267I probably benign Het
Thra G A 11: 98,651,715 (GRCm39) R79H probably damaging Het
Tie1 T C 4: 118,347,032 (GRCm39) probably benign Het
Umodl1 A C 17: 31,217,152 (GRCm39) Q1128P possibly damaging Het
Vps35 G A 8: 86,010,633 (GRCm39) R237C probably benign Het
Zfp78 T A 7: 6,382,074 (GRCm39) C343S probably damaging Het
Zfp85 A G 13: 67,897,326 (GRCm39) Y249H probably damaging Het
Other mutations in Abca16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Abca16 APN 7 120,022,982 (GRCm39) missense probably benign 0.08
IGL00590:Abca16 APN 7 120,023,038 (GRCm39) missense probably damaging 1.00
IGL01320:Abca16 APN 7 120,038,422 (GRCm39) missense probably damaging 1.00
IGL01322:Abca16 APN 7 120,038,422 (GRCm39) missense probably damaging 1.00
IGL01613:Abca16 APN 7 120,140,500 (GRCm39) missense probably benign 0.03
IGL01774:Abca16 APN 7 120,021,024 (GRCm39) splice site probably benign
IGL01774:Abca16 APN 7 120,077,058 (GRCm39) missense probably damaging 1.00
IGL01797:Abca16 APN 7 120,113,760 (GRCm39) missense probably benign 0.15
IGL02406:Abca16 APN 7 120,139,825 (GRCm39) missense probably damaging 1.00
IGL02437:Abca16 APN 7 120,132,952 (GRCm39) missense probably benign 0.00
IGL02541:Abca16 APN 7 120,113,881 (GRCm39) missense possibly damaging 0.91
IGL02576:Abca16 APN 7 120,032,678 (GRCm39) missense probably benign 0.05
IGL02578:Abca16 APN 7 120,023,179 (GRCm39) critical splice donor site probably null
IGL03156:Abca16 APN 7 120,023,074 (GRCm39) missense possibly damaging 0.69
IGL03381:Abca16 APN 7 120,127,041 (GRCm39) missense probably benign 0.12
PIT4802001:Abca16 UTSW 7 120,139,351 (GRCm39) missense probably benign 0.31
R0024:Abca16 UTSW 7 120,032,608 (GRCm39) missense probably damaging 1.00
R0026:Abca16 UTSW 7 120,077,146 (GRCm39) splice site probably benign
R0026:Abca16 UTSW 7 120,077,146 (GRCm39) splice site probably benign
R0123:Abca16 UTSW 7 120,139,378 (GRCm39) missense probably damaging 1.00
R0134:Abca16 UTSW 7 120,139,378 (GRCm39) missense probably damaging 1.00
R0225:Abca16 UTSW 7 120,139,378 (GRCm39) missense probably damaging 1.00
R0346:Abca16 UTSW 7 120,035,155 (GRCm39) missense probably damaging 1.00
R0355:Abca16 UTSW 7 120,023,021 (GRCm39) missense possibly damaging 0.68
R0358:Abca16 UTSW 7 120,143,939 (GRCm39) missense probably benign 0.01
R0525:Abca16 UTSW 7 120,065,033 (GRCm39) nonsense probably null
R0617:Abca16 UTSW 7 120,032,834 (GRCm39) splice site probably benign
R0625:Abca16 UTSW 7 120,035,116 (GRCm39) missense probably damaging 1.00
R0835:Abca16 UTSW 7 120,065,007 (GRCm39) missense probably benign 0.42
R1445:Abca16 UTSW 7 120,119,256 (GRCm39) missense probably benign 0.41
R1535:Abca16 UTSW 7 120,139,928 (GRCm39) missense probably benign 0.30
R1567:Abca16 UTSW 7 120,030,352 (GRCm39) missense probably benign 0.08
R1694:Abca16 UTSW 7 120,119,307 (GRCm39) missense probably damaging 1.00
R1860:Abca16 UTSW 7 120,133,986 (GRCm39) missense probably benign 0.02
R1876:Abca16 UTSW 7 120,032,608 (GRCm39) missense probably damaging 1.00
R1913:Abca16 UTSW 7 120,140,463 (GRCm39) missense probably benign 0.04
R1940:Abca16 UTSW 7 120,032,832 (GRCm39) splice site probably benign
R2042:Abca16 UTSW 7 120,143,941 (GRCm39) missense probably benign
R2115:Abca16 UTSW 7 120,139,868 (GRCm39) missense probably damaging 1.00
R2122:Abca16 UTSW 7 120,119,184 (GRCm39) missense probably damaging 1.00
R2265:Abca16 UTSW 7 120,030,383 (GRCm39) missense probably benign 0.03
R2267:Abca16 UTSW 7 120,030,383 (GRCm39) missense probably benign 0.03
R2269:Abca16 UTSW 7 120,030,383 (GRCm39) missense probably benign 0.03
R2993:Abca16 UTSW 7 120,134,384 (GRCm39) missense probably damaging 1.00
R3055:Abca16 UTSW 7 120,035,074 (GRCm39) missense probably benign 0.05
R3956:Abca16 UTSW 7 120,126,975 (GRCm39) missense probably damaging 0.96
R4114:Abca16 UTSW 7 120,126,290 (GRCm39) missense probably benign 0.06
R4441:Abca16 UTSW 7 120,127,024 (GRCm39) missense probably benign 0.04
R4601:Abca16 UTSW 7 120,035,920 (GRCm39) missense probably damaging 0.98
R4706:Abca16 UTSW 7 120,064,988 (GRCm39) missense probably damaging 1.00
R4807:Abca16 UTSW 7 120,139,832 (GRCm39) missense probably damaging 1.00
R4824:Abca16 UTSW 7 120,074,702 (GRCm39) missense possibly damaging 0.86
R4937:Abca16 UTSW 7 120,126,309 (GRCm39) missense probably damaging 0.98
R5152:Abca16 UTSW 7 120,139,846 (GRCm39) missense probably benign 0.02
R5257:Abca16 UTSW 7 120,035,992 (GRCm39) critical splice donor site probably null
R5258:Abca16 UTSW 7 120,035,992 (GRCm39) critical splice donor site probably null
R5330:Abca16 UTSW 7 120,102,600 (GRCm39) missense probably benign 0.15
R5388:Abca16 UTSW 7 120,139,969 (GRCm39) critical splice donor site probably null
R5590:Abca16 UTSW 7 120,143,995 (GRCm39) missense probably damaging 0.98
R5810:Abca16 UTSW 7 120,035,155 (GRCm39) missense probably damaging 1.00
R6030:Abca16 UTSW 7 120,133,021 (GRCm39) missense probably benign
R6030:Abca16 UTSW 7 120,133,021 (GRCm39) missense probably benign
R6161:Abca16 UTSW 7 120,139,934 (GRCm39) missense probably damaging 1.00
R6313:Abca16 UTSW 7 120,126,344 (GRCm39) missense probably damaging 1.00
R6485:Abca16 UTSW 7 120,026,390 (GRCm39) nonsense probably null
R6527:Abca16 UTSW 7 120,076,995 (GRCm39) missense possibly damaging 0.95
R6772:Abca16 UTSW 7 120,126,276 (GRCm39) missense probably damaging 1.00
R6885:Abca16 UTSW 7 120,119,332 (GRCm39) missense probably benign 0.07
R6899:Abca16 UTSW 7 120,126,264 (GRCm39) missense probably damaging 1.00
R6941:Abca16 UTSW 7 120,140,370 (GRCm39) missense probably damaging 1.00
R6990:Abca16 UTSW 7 120,126,950 (GRCm39) missense probably benign 0.00
R7059:Abca16 UTSW 7 120,020,971 (GRCm39) missense probably benign 0.00
R7144:Abca16 UTSW 7 120,032,796 (GRCm39) missense possibly damaging 0.89
R7146:Abca16 UTSW 7 120,126,974 (GRCm39) missense possibly damaging 0.46
R7193:Abca16 UTSW 7 120,026,409 (GRCm39) missense probably damaging 1.00
R7308:Abca16 UTSW 7 120,022,993 (GRCm39) missense probably benign 0.01
R7449:Abca16 UTSW 7 120,035,131 (GRCm39) missense possibly damaging 0.95
R7571:Abca16 UTSW 7 120,119,211 (GRCm39) missense probably benign 0.11
R7617:Abca16 UTSW 7 120,102,694 (GRCm39) nonsense probably null
R7646:Abca16 UTSW 7 120,113,937 (GRCm39) missense probably benign 0.04
R7750:Abca16 UTSW 7 120,113,928 (GRCm39) missense probably benign 0.09
R7763:Abca16 UTSW 7 120,113,825 (GRCm39) missense probably damaging 1.00
R7840:Abca16 UTSW 7 120,074,689 (GRCm39) missense probably benign 0.00
R7946:Abca16 UTSW 7 120,126,398 (GRCm39) missense probably benign 0.01
R8018:Abca16 UTSW 7 120,132,866 (GRCm39) missense probably benign 0.04
R8170:Abca16 UTSW 7 120,065,005 (GRCm39) missense probably damaging 1.00
R8413:Abca16 UTSW 7 120,023,123 (GRCm39) missense probably benign 0.06
R8461:Abca16 UTSW 7 120,035,918 (GRCm39) missense possibly damaging 0.95
R8858:Abca16 UTSW 7 120,052,327 (GRCm39) missense probably benign
R8881:Abca16 UTSW 7 120,074,794 (GRCm39) missense probably benign 0.18
R9272:Abca16 UTSW 7 120,076,993 (GRCm39) missense probably benign 0.13
R9303:Abca16 UTSW 7 120,126,989 (GRCm39) missense probably benign 0.25
R9305:Abca16 UTSW 7 120,126,989 (GRCm39) missense probably benign 0.25
R9320:Abca16 UTSW 7 120,139,320 (GRCm39) missense probably damaging 0.98
R9413:Abca16 UTSW 7 120,126,422 (GRCm39) missense probably benign 0.01
R9512:Abca16 UTSW 7 120,022,963 (GRCm39) missense probably benign 0.01
R9559:Abca16 UTSW 7 120,021,019 (GRCm39) critical splice donor site probably null
R9641:Abca16 UTSW 7 120,126,308 (GRCm39) missense possibly damaging 0.52
R9643:Abca16 UTSW 7 120,065,023 (GRCm39) missense possibly damaging 0.96
R9674:Abca16 UTSW 7 120,074,668 (GRCm39) critical splice acceptor site probably null
R9714:Abca16 UTSW 7 120,030,383 (GRCm39) missense probably benign 0.01
R9799:Abca16 UTSW 7 120,132,998 (GRCm39) missense probably benign 0.00
R9800:Abca16 UTSW 7 120,119,283 (GRCm39) missense possibly damaging 0.68
RF020:Abca16 UTSW 7 120,132,880 (GRCm39) missense possibly damaging 0.90
X0066:Abca16 UTSW 7 120,102,609 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TAAATTCTGCCAGCTGGAGG -3'
(R):5'- TTAGCCGCAGAATTGAAGAGTAGC -3'

Sequencing Primer
(F):5'- GAGGCATTTGTCGTGCATTACAAC -3'
(R):5'- TACTTCCAGAAAAAGAAG -3'
Posted On 2022-09-12