Incidental Mutation 'R9616:Trpm1'
ID 724585
Institutional Source Beutler Lab
Gene Symbol Trpm1
Ensembl Gene ENSMUSG00000030523
Gene Name transient receptor potential cation channel, subfamily M, member 1
Synonyms Mlsn1, 4732499L03Rik, LTRPC1, melastatin
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9616 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 64153835-64269775 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 64208384 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Glycine at position 324 (V324G)
Ref Sequence ENSEMBL: ENSMUSP00000082318 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085222] [ENSMUST00000177102] [ENSMUST00000205348] [ENSMUST00000205731] [ENSMUST00000205994] [ENSMUST00000206263] [ENSMUST00000206277] [ENSMUST00000206314] [ENSMUST00000206706]
AlphaFold Q2TV84
Predicted Effect probably damaging
Transcript: ENSMUST00000085222
AA Change: V324G

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000082318
Gene: ENSMUSG00000030523
AA Change: V324G

DomainStartEndE-ValueType
low complexity region 8 28 N/A INTRINSIC
low complexity region 183 195 N/A INTRINSIC
low complexity region 289 307 N/A INTRINSIC
low complexity region 456 491 N/A INTRINSIC
Blast:ANK 505 533 1e-5 BLAST
low complexity region 621 650 N/A INTRINSIC
low complexity region 823 835 N/A INTRINSIC
transmembrane domain 876 895 N/A INTRINSIC
Pfam:Ion_trans 907 1120 6e-16 PFAM
transmembrane domain 1150 1167 N/A INTRINSIC
low complexity region 1216 1225 N/A INTRINSIC
PDB:3E7K|H 1228 1279 1e-7 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000177102
AA Change: V208G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000134947
Gene: ENSMUSG00000030523
AA Change: V208G

DomainStartEndE-ValueType
low complexity region 67 79 N/A INTRINSIC
low complexity region 173 191 N/A INTRINSIC
low complexity region 340 375 N/A INTRINSIC
Blast:ANK 389 417 1e-5 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000205348
AA Change: V324G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000205684
Predicted Effect probably damaging
Transcript: ENSMUST00000205731
AA Change: V208G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000205994
Predicted Effect probably damaging
Transcript: ENSMUST00000206263
AA Change: V208G

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000206277
AA Change: V324G

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
Predicted Effect probably benign
Transcript: ENSMUST00000206314
Predicted Effect probably damaging
Transcript: ENSMUST00000206706
AA Change: V191G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the transient receptor potential melastatin subfamily of transient receptor potential ion channels. The encoded protein is a calcium permeable cation channel that is expressed in melanocytes and may play a role in melanin synthesis. Specific mutations in this gene are the cause autosomal recessive complete congenital stationary night blindness-1C. The expression of this protein is inversely correlated with melanoma aggressiveness and as such it is used as a prognostic marker for melanoma metastasis. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous mutants have defects in rod and cone electrophysiology affecting the photoresponses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110040M04Rik T A 1: 151,204,729 D189E probably benign Het
Abca13 A T 11: 9,290,501 H788L probably benign Het
Abcb1b A G 5: 8,812,779 I154V probably benign Het
Acsm4 A G 7: 119,694,649 N81S probably benign Het
Adamts5 G A 16: 85,862,786 H873Y probably benign Het
Aox4 C T 1: 58,228,861 T200I possibly damaging Het
Arhgap33 A G 7: 30,529,942 V336A probably damaging Het
Brca1 C T 11: 101,525,857 E484K probably damaging Het
Capn13 T A 17: 73,365,969 D113V probably benign Het
Catsper2 TAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCT TAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCT 2: 121,397,572 probably benign Het
Ceacam3 G A 7: 17,158,153 E274K Het
Cfh A T 1: 140,102,516 I891K probably damaging Het
Cgn A G 3: 94,763,025 S1041P probably damaging Het
Cldn18 T C 9: 99,698,862 D111G probably benign Het
Cnp G A 11: 100,576,435 R68Q probably benign Het
Cntn4 T A 6: 106,697,564 C1008* probably null Het
Cntnap5a T C 1: 116,101,593 I259T probably benign Het
Cubn A G 2: 13,314,718 I2897T probably benign Het
Cyp2c39 T A 19: 39,513,204 L67Q probably damaging Het
Dclk1 G A 3: 55,480,433 C100Y probably damaging Het
Ddc C T 11: 11,822,288 W349* probably null Het
Dennd3 A G 15: 73,568,714 E1198G probably benign Het
Dnah1 T C 14: 31,304,443 D826G probably null Het
Dpp4 T C 2: 62,387,085 Y56C probably damaging Het
Etv6 A G 6: 134,266,332 D350G possibly damaging Het
Fam129a T C 1: 151,636,442 Y32H probably damaging Het
Fat1 C A 8: 44,953,038 P942Q probably damaging Het
Fbxl5 A G 5: 43,758,817 F418L probably benign Het
Fbxo11 T A 17: 88,008,670 H368L Het
Fhl2 G T 1: 43,128,386 H182Q probably damaging Het
Gabpa T A 16: 84,852,573 C223S probably damaging Het
Gigyf2 T C 1: 87,428,604 I803T unknown Het
Greb1 A T 12: 16,740,037 N3K probably damaging Het
Hmcn1 T G 1: 150,808,722 S366R probably benign Het
Il17b A G 18: 61,692,292 Q133R probably benign Het
Inha T A 1: 75,509,567 S169T probably benign Het
Itsn1 G A 16: 91,853,167 R243H probably benign Het
Kcnu1 G GA 8: 25,913,647 probably null Het
Kdm1b A G 13: 47,080,554 E788G probably damaging Het
Kdm2a A T 19: 4,320,280 I1059N probably damaging Het
Klk1b9 G T 7: 43,979,371 G100C probably benign Het
Knl1 T C 2: 119,069,513 V565A probably benign Het
Knl1 A T 2: 119,076,944 N1650Y probably damaging Het
Lpp T C 16: 24,761,969 V270A probably benign Het
Lrrc15 A G 16: 30,273,699 L274P probably damaging Het
Mertk C T 2: 128,801,335 L885F probably benign Het
Mpst T A 15: 78,410,161 L31* probably null Het
Ms4a10 T C 19: 10,967,076 T115A possibly damaging Het
Myof A G 19: 37,934,815 I1330T possibly damaging Het
Ncam2 T C 16: 81,443,254 I201T probably damaging Het
Nefh T A 11: 4,939,443 K1059* probably null Het
Nek1 T C 8: 61,020,073 Y168H probably damaging Het
Nek11 T A 9: 105,204,812 T531S probably damaging Het
Nelfa G A 5: 33,901,783 P243S possibly damaging Het
Notum G T 11: 120,660,148 T64K Het
Olfr1504 A G 19: 13,887,497 S238P probably damaging Het
Olfr159 T A 4: 43,770,193 K273* probably null Het
Olfr691 A C 7: 105,337,313 Y134* probably null Het
Otof A G 5: 30,382,364 I1035T possibly damaging Het
Otud3 A G 4: 138,897,614 Y259H probably benign Het
Per1 G T 11: 69,102,728 C368F probably damaging Het
Pitrm1 G T 13: 6,555,566 R183L probably damaging Het
Prl3a1 C T 13: 27,275,135 A119V Het
Pycard C T 7: 127,993,604 G17E probably benign Het
Rnf13 A G 3: 57,833,009 D249G possibly damaging Het
Sdhaf2 T C 19: 10,517,325 Y33C probably damaging Het
Sdk2 A G 11: 113,800,235 V1838A probably benign Het
Sgo2b C T 8: 63,927,240 V853I probably benign Het
Slc1a4 T C 11: 20,332,403 T24A probably benign Het
Slc8a1 T C 17: 81,647,978 T544A probably benign Het
Sntg2 T C 12: 30,276,733 N143S probably benign Het
Sphkap T C 1: 83,277,268 E920G probably damaging Het
Srgap2 T A 1: 131,325,090 H132L Het
Srgap3 A T 6: 112,771,563 V376D probably damaging Het
Stxbp5l T C 16: 37,215,952 K434E probably damaging Het
Tab2 A T 10: 7,919,241 N492K possibly damaging Het
Tbc1d32 T C 10: 56,161,150 Q666R possibly damaging Het
Tekt4 T C 17: 25,473,808 probably null Het
Tnni3k G A 3: 154,962,087 Q230* probably null Het
Trp53bp1 A C 2: 121,236,176 S690A probably benign Het
Trpa1 C A 1: 14,918,853 probably benign Het
Usp29 A G 7: 6,963,180 E674G possibly damaging Het
Vmn2r59 T C 7: 42,011,875 R839G probably damaging Het
Vmn2r6 A G 3: 64,538,303 L667P probably damaging Het
Vmn2r91 T A 17: 18,136,043 F657L possibly damaging Het
Vps13d A G 4: 145,098,131 V2923A Het
Xylb T A 9: 119,371,956 L220Q probably damaging Het
Zbtb10 C T 3: 9,251,413 T95M probably benign Het
Zfp263 C T 16: 3,749,618 P599L probably damaging Het
Zfp532 A G 18: 65,656,568 E1026G probably benign Het
Zfp78 A G 7: 6,379,079 N376S probably benign Het
Other mutations in Trpm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Trpm1 APN 7 64243450 missense probably damaging 1.00
IGL00465:Trpm1 APN 7 64247467 missense possibly damaging 0.94
IGL01118:Trpm1 APN 7 64235824 missense probably benign 0.24
IGL01148:Trpm1 APN 7 64243564 missense probably damaging 1.00
IGL01303:Trpm1 APN 7 64210830 critical splice acceptor site probably benign 0.00
IGL01432:Trpm1 APN 7 64235019 missense probably benign 0.18
IGL01433:Trpm1 APN 7 64204528 missense probably damaging 1.00
IGL01506:Trpm1 APN 7 64243581 missense probably damaging 1.00
IGL01626:Trpm1 APN 7 64268889 missense probably damaging 1.00
IGL01640:Trpm1 APN 7 64226897 missense probably damaging 1.00
IGL01899:Trpm1 APN 7 64234994 missense probably benign 0.24
IGL01959:Trpm1 APN 7 64208975 missense possibly damaging 0.81
IGL02210:Trpm1 APN 7 64210865 missense probably damaging 1.00
IGL02268:Trpm1 APN 7 64217614 missense probably damaging 0.96
IGL02331:Trpm1 APN 7 64235052 missense probably benign 0.30
IGL02334:Trpm1 APN 7 64245942 critical splice acceptor site probably null
IGL02407:Trpm1 APN 7 64219121 missense probably damaging 1.00
IGL02425:Trpm1 APN 7 64240427 missense probably damaging 0.96
IGL02485:Trpm1 APN 7 64269114 missense possibly damaging 0.52
IGL02635:Trpm1 APN 7 64199224 missense probably benign 0.00
IGL02640:Trpm1 APN 7 64219133 missense probably damaging 0.97
IGL02827:Trpm1 APN 7 64219160 missense probably null 1.00
PIT4458001:Trpm1 UTSW 7 64268561 missense possibly damaging 0.94
PIT4544001:Trpm1 UTSW 7 64199250 intron probably benign
R0012:Trpm1 UTSW 7 64268591 missense possibly damaging 0.88
R0014:Trpm1 UTSW 7 64248222 missense probably damaging 1.00
R0056:Trpm1 UTSW 7 64243586 missense probably damaging 1.00
R0445:Trpm1 UTSW 7 64244842 unclassified probably benign
R0463:Trpm1 UTSW 7 64220254 missense probably benign 0.05
R0469:Trpm1 UTSW 7 64223758 missense probably damaging 1.00
R0510:Trpm1 UTSW 7 64223758 missense probably damaging 1.00
R1301:Trpm1 UTSW 7 64203053 splice site probably null
R1397:Trpm1 UTSW 7 64217658 missense probably damaging 1.00
R1588:Trpm1 UTSW 7 64223817 missense possibly damaging 0.93
R1618:Trpm1 UTSW 7 64240535 missense probably damaging 1.00
R1724:Trpm1 UTSW 7 64235821 nonsense probably null
R1827:Trpm1 UTSW 7 64235007 missense probably damaging 1.00
R1829:Trpm1 UTSW 7 64226782 missense probably damaging 1.00
R1835:Trpm1 UTSW 7 64230268 missense probably damaging 1.00
R1864:Trpm1 UTSW 7 64268016 missense probably damaging 1.00
R1895:Trpm1 UTSW 7 64223808 missense probably damaging 1.00
R1946:Trpm1 UTSW 7 64223808 missense probably damaging 1.00
R1959:Trpm1 UTSW 7 64230230 missense probably damaging 1.00
R1960:Trpm1 UTSW 7 64230230 missense probably damaging 1.00
R1980:Trpm1 UTSW 7 64208434 missense possibly damaging 0.83
R1989:Trpm1 UTSW 7 64209032 intron probably null
R2054:Trpm1 UTSW 7 64240555 missense possibly damaging 0.69
R2156:Trpm1 UTSW 7 64234988 missense probably damaging 1.00
R2251:Trpm1 UTSW 7 64209976 missense probably damaging 1.00
R3051:Trpm1 UTSW 7 64269101 missense probably damaging 1.00
R3148:Trpm1 UTSW 7 64235012 missense probably benign 0.00
R3195:Trpm1 UTSW 7 64199313 nonsense probably null
R3615:Trpm1 UTSW 7 64243570 missense probably damaging 1.00
R3616:Trpm1 UTSW 7 64243570 missense probably damaging 1.00
R3623:Trpm1 UTSW 7 64244853 missense probably damaging 1.00
R3624:Trpm1 UTSW 7 64244853 missense probably damaging 1.00
R3721:Trpm1 UTSW 7 64217727 intron probably benign
R3822:Trpm1 UTSW 7 64217703 intron probably benign
R4441:Trpm1 UTSW 7 64201918 missense probably damaging 1.00
R4490:Trpm1 UTSW 7 64208912 nonsense probably null
R4666:Trpm1 UTSW 7 64203034 missense probably damaging 1.00
R4701:Trpm1 UTSW 7 64243500 missense probably damaging 1.00
R4781:Trpm1 UTSW 7 64235052 missense probably benign 0.30
R4811:Trpm1 UTSW 7 64208306 missense probably damaging 1.00
R5017:Trpm1 UTSW 7 64244832 unclassified probably benign
R5030:Trpm1 UTSW 7 64235831 missense probably damaging 1.00
R5195:Trpm1 UTSW 7 64237693 missense possibly damaging 0.84
R5238:Trpm1 UTSW 7 64268954 missense probably damaging 1.00
R5304:Trpm1 UTSW 7 64208946 missense probably benign 0.00
R5575:Trpm1 UTSW 7 64220270 missense possibly damaging 0.95
R5613:Trpm1 UTSW 7 64208411 missense probably damaging 1.00
R5855:Trpm1 UTSW 7 64268962 nonsense probably null
R5947:Trpm1 UTSW 7 64223799 missense probably benign 0.07
R5988:Trpm1 UTSW 7 64226805 missense probably benign 0.16
R6054:Trpm1 UTSW 7 64268702 missense probably benign 0.00
R6088:Trpm1 UTSW 7 64267976 missense probably damaging 0.98
R6259:Trpm1 UTSW 7 64268478 missense possibly damaging 0.47
R6379:Trpm1 UTSW 7 64199194 missense probably benign 0.00
R6380:Trpm1 UTSW 7 64268297 missense probably benign 0.24
R6429:Trpm1 UTSW 7 64268504 missense probably benign 0.00
R6600:Trpm1 UTSW 7 64154033 start codon destroyed probably null 0.56
R6622:Trpm1 UTSW 7 64240595 missense probably damaging 0.96
R6939:Trpm1 UTSW 7 64268297 missense probably benign 0.03
R6944:Trpm1 UTSW 7 64243433 missense probably damaging 1.00
R7025:Trpm1 UTSW 7 64226714 critical splice acceptor site probably null
R7112:Trpm1 UTSW 7 64235845 missense probably damaging 0.97
R7168:Trpm1 UTSW 7 64268697 missense probably benign 0.01
R7219:Trpm1 UTSW 7 64204585 missense possibly damaging 0.68
R7224:Trpm1 UTSW 7 64219106 critical splice acceptor site probably null
R7285:Trpm1 UTSW 7 64209981 nonsense probably null
R7367:Trpm1 UTSW 7 64268801 missense probably benign 0.06
R7449:Trpm1 UTSW 7 64208975 missense probably benign 0.14
R7466:Trpm1 UTSW 7 64240582 missense probably damaging 0.99
R7498:Trpm1 UTSW 7 64208909 missense possibly damaging 0.93
R7581:Trpm1 UTSW 7 64204555 missense probably benign 0.00
R7776:Trpm1 UTSW 7 64248191 missense probably benign 0.04
R8062:Trpm1 UTSW 7 64201941 missense probably benign 0.18
R8069:Trpm1 UTSW 7 64208970 missense possibly damaging 0.55
R8157:Trpm1 UTSW 7 64199269 missense probably damaging 1.00
R8219:Trpm1 UTSW 7 64201951 missense probably benign 0.35
R8258:Trpm1 UTSW 7 64269029 missense probably benign 0.10
R8259:Trpm1 UTSW 7 64269029 missense probably benign 0.10
R8320:Trpm1 UTSW 7 64268793 missense possibly damaging 0.56
R8536:Trpm1 UTSW 7 64247407 missense probably damaging 1.00
R8544:Trpm1 UTSW 7 64224608 splice site probably null
R8813:Trpm1 UTSW 7 64202008 missense possibly damaging 0.68
R8912:Trpm1 UTSW 7 64268880 missense probably benign 0.06
R8954:Trpm1 UTSW 7 64208341 missense probably damaging 0.98
R9139:Trpm1 UTSW 7 64199195 missense probably benign 0.00
R9205:Trpm1 UTSW 7 64240571 missense possibly damaging 0.66
R9258:Trpm1 UTSW 7 64234965 missense probably benign 0.01
R9283:Trpm1 UTSW 7 64223875 missense probably benign 0.18
R9394:Trpm1 UTSW 7 64268732 missense probably benign 0.00
R9430:Trpm1 UTSW 7 64223698 missense probably benign 0.38
R9537:Trpm1 UTSW 7 64153868 unclassified probably benign
R9774:Trpm1 UTSW 7 64248293 missense possibly damaging 0.90
X0026:Trpm1 UTSW 7 64268910 missense probably benign 0.05
Z1176:Trpm1 UTSW 7 64203131 critical splice donor site probably null
Z1176:Trpm1 UTSW 7 64204594 critical splice donor site probably null
Z1177:Trpm1 UTSW 7 64217691 missense unknown
Predicted Primers PCR Primer
(F):5'- CGAAGCATTGGTCAACATTAGC -3'
(R):5'- AGCTCCTGGGCATTCTCATG -3'

Sequencing Primer
(F):5'- TGGTCAACATTAGCACTACAAGG -3'
(R):5'- CATTCTCATGCTGATCTCGGGAG -3'
Posted On 2022-09-12