Incidental Mutation 'R9616:Trpm1'
ID 724585
Institutional Source Beutler Lab
Gene Symbol Trpm1
Ensembl Gene ENSMUSG00000030523
Gene Name transient receptor potential cation channel, subfamily M, member 1
Synonyms Mlsn1, melastatin, 4732499L03Rik, LTRPC1
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9616 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 63803583-63919523 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 63858132 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glycine at position 324 (V324G)
Ref Sequence ENSEMBL: ENSMUSP00000082318 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085222] [ENSMUST00000177102] [ENSMUST00000205348] [ENSMUST00000205731] [ENSMUST00000205994] [ENSMUST00000206263] [ENSMUST00000206277] [ENSMUST00000206314] [ENSMUST00000206706]
AlphaFold Q2TV84
Predicted Effect probably damaging
Transcript: ENSMUST00000085222
AA Change: V324G

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000082318
Gene: ENSMUSG00000030523
AA Change: V324G

DomainStartEndE-ValueType
low complexity region 8 28 N/A INTRINSIC
low complexity region 183 195 N/A INTRINSIC
low complexity region 289 307 N/A INTRINSIC
low complexity region 456 491 N/A INTRINSIC
Blast:ANK 505 533 1e-5 BLAST
low complexity region 621 650 N/A INTRINSIC
low complexity region 823 835 N/A INTRINSIC
transmembrane domain 876 895 N/A INTRINSIC
Pfam:Ion_trans 907 1120 6e-16 PFAM
transmembrane domain 1150 1167 N/A INTRINSIC
low complexity region 1216 1225 N/A INTRINSIC
PDB:3E7K|H 1228 1279 1e-7 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000177102
AA Change: V208G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000134947
Gene: ENSMUSG00000030523
AA Change: V208G

DomainStartEndE-ValueType
low complexity region 67 79 N/A INTRINSIC
low complexity region 173 191 N/A INTRINSIC
low complexity region 340 375 N/A INTRINSIC
Blast:ANK 389 417 1e-5 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000205348
AA Change: V324G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000205684
Predicted Effect probably damaging
Transcript: ENSMUST00000205731
AA Change: V208G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000205994
Predicted Effect probably damaging
Transcript: ENSMUST00000206263
AA Change: V208G

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000206277
AA Change: V324G

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
Predicted Effect probably benign
Transcript: ENSMUST00000206314
Predicted Effect probably damaging
Transcript: ENSMUST00000206706
AA Change: V191G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the transient receptor potential melastatin subfamily of transient receptor potential ion channels. The encoded protein is a calcium permeable cation channel that is expressed in melanocytes and may play a role in melanin synthesis. Specific mutations in this gene are the cause autosomal recessive complete congenital stationary night blindness-1C. The expression of this protein is inversely correlated with melanoma aggressiveness and as such it is used as a prognostic marker for melanoma metastasis. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous mutants have defects in rod and cone electrophysiology affecting the photoresponses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110040M04Rik T A 1: 151,080,480 (GRCm39) D189E probably benign Het
Abca13 A T 11: 9,240,501 (GRCm39) H788L probably benign Het
Abcb1b A G 5: 8,862,779 (GRCm39) I154V probably benign Het
Acsm4 A G 7: 119,293,872 (GRCm39) N81S probably benign Het
Adamts5 G A 16: 85,659,674 (GRCm39) H873Y probably benign Het
Aox4 C T 1: 58,268,020 (GRCm39) T200I possibly damaging Het
Arhgap33 A G 7: 30,229,367 (GRCm39) V336A probably damaging Het
Brca1 C T 11: 101,416,683 (GRCm39) E484K probably damaging Het
Capn13 T A 17: 73,672,964 (GRCm39) D113V probably benign Het
Catsper2 TAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCT TAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCT 2: 121,228,053 (GRCm39) probably benign Het
Ceacam3 G A 7: 16,892,078 (GRCm39) E274K Het
Cfh A T 1: 140,030,254 (GRCm39) I891K probably damaging Het
Cgn A G 3: 94,670,332 (GRCm39) S1041P probably damaging Het
Cldn18 T C 9: 99,580,915 (GRCm39) D111G probably benign Het
Cnp G A 11: 100,467,261 (GRCm39) R68Q probably benign Het
Cntn4 T A 6: 106,674,525 (GRCm39) C1008* probably null Het
Cntnap5a T C 1: 116,029,323 (GRCm39) I259T probably benign Het
Cubn A G 2: 13,319,529 (GRCm39) I2897T probably benign Het
Cyp2c39 T A 19: 39,501,648 (GRCm39) L67Q probably damaging Het
Dclk1 G A 3: 55,387,854 (GRCm39) C100Y probably damaging Het
Ddc C T 11: 11,772,288 (GRCm39) W349* probably null Het
Dennd3 A G 15: 73,440,563 (GRCm39) E1198G probably benign Het
Dnah1 T C 14: 31,026,400 (GRCm39) D826G probably null Het
Dpp4 T C 2: 62,217,429 (GRCm39) Y56C probably damaging Het
Etv6 A G 6: 134,243,295 (GRCm39) D350G possibly damaging Het
Fat1 C A 8: 45,406,075 (GRCm39) P942Q probably damaging Het
Fbxl5 A G 5: 43,916,159 (GRCm39) F418L probably benign Het
Fbxo11 T A 17: 88,316,098 (GRCm39) H368L Het
Fhl2 G T 1: 43,167,546 (GRCm39) H182Q probably damaging Het
Gabpa T A 16: 84,649,461 (GRCm39) C223S probably damaging Het
Gigyf2 T C 1: 87,356,326 (GRCm39) I803T unknown Het
Greb1 A T 12: 16,790,038 (GRCm39) N3K probably damaging Het
Hmcn1 T G 1: 150,684,473 (GRCm39) S366R probably benign Het
Il17b A G 18: 61,825,363 (GRCm39) Q133R probably benign Het
Inha T A 1: 75,486,211 (GRCm39) S169T probably benign Het
Itsn1 G A 16: 91,650,055 (GRCm39) R243H probably benign Het
Kcnu1 G GA 8: 26,403,675 (GRCm39) probably null Het
Kdm1b A G 13: 47,234,030 (GRCm39) E788G probably damaging Het
Kdm2a A T 19: 4,370,308 (GRCm39) I1059N probably damaging Het
Klk1b9 G T 7: 43,628,795 (GRCm39) G100C probably benign Het
Knl1 T C 2: 118,899,994 (GRCm39) V565A probably benign Het
Knl1 A T 2: 118,907,425 (GRCm39) N1650Y probably damaging Het
Lpp T C 16: 24,580,719 (GRCm39) V270A probably benign Het
Lrrc15 A G 16: 30,092,517 (GRCm39) L274P probably damaging Het
Mertk C T 2: 128,643,255 (GRCm39) L885F probably benign Het
Mpst T A 15: 78,294,361 (GRCm39) L31* probably null Het
Ms4a10 T C 19: 10,944,440 (GRCm39) T115A possibly damaging Het
Myof A G 19: 37,923,263 (GRCm39) I1330T possibly damaging Het
Ncam2 T C 16: 81,240,142 (GRCm39) I201T probably damaging Het
Nefh T A 11: 4,889,443 (GRCm39) K1059* probably null Het
Nek1 T C 8: 61,473,107 (GRCm39) Y168H probably damaging Het
Nek11 T A 9: 105,082,011 (GRCm39) T531S probably damaging Het
Nelfa G A 5: 34,059,127 (GRCm39) P243S possibly damaging Het
Niban1 T C 1: 151,512,193 (GRCm39) Y32H probably damaging Het
Notum G T 11: 120,550,974 (GRCm39) T64K Het
Or13c7d T A 4: 43,770,193 (GRCm39) K273* probably null Het
Or52b2 A C 7: 104,986,520 (GRCm39) Y134* probably null Het
Or9i16 A G 19: 13,864,861 (GRCm39) S238P probably damaging Het
Otof A G 5: 30,539,708 (GRCm39) I1035T possibly damaging Het
Otud3 A G 4: 138,624,925 (GRCm39) Y259H probably benign Het
Per1 G T 11: 68,993,554 (GRCm39) C368F probably damaging Het
Pitrm1 G T 13: 6,605,602 (GRCm39) R183L probably damaging Het
Prl3a1 C T 13: 27,459,118 (GRCm39) A119V Het
Pycard C T 7: 127,592,776 (GRCm39) G17E probably benign Het
Rnf13 A G 3: 57,740,430 (GRCm39) D249G possibly damaging Het
Sdhaf2 T C 19: 10,494,689 (GRCm39) Y33C probably damaging Het
Sdk2 A G 11: 113,691,061 (GRCm39) V1838A probably benign Het
Sgo2b C T 8: 64,380,274 (GRCm39) V853I probably benign Het
Slc1a4 T C 11: 20,282,403 (GRCm39) T24A probably benign Het
Slc8a1 T C 17: 81,955,407 (GRCm39) T544A probably benign Het
Sntg2 T C 12: 30,326,732 (GRCm39) N143S probably benign Het
Sphkap T C 1: 83,254,989 (GRCm39) E920G probably damaging Het
Srgap2 T A 1: 131,252,828 (GRCm39) H132L Het
Srgap3 A T 6: 112,748,524 (GRCm39) V376D probably damaging Het
Stxbp5l T C 16: 37,036,314 (GRCm39) K434E probably damaging Het
Tab2 A T 10: 7,795,005 (GRCm39) N492K possibly damaging Het
Tbc1d32 T C 10: 56,037,246 (GRCm39) Q666R possibly damaging Het
Tekt4 T C 17: 25,692,782 (GRCm39) probably null Het
Tnni3k G A 3: 154,667,724 (GRCm39) Q230* probably null Het
Trp53bp1 A C 2: 121,066,657 (GRCm39) S690A probably benign Het
Trpa1 C A 1: 14,989,077 (GRCm39) probably benign Het
Usp29 A G 7: 6,966,179 (GRCm39) E674G possibly damaging Het
Vmn2r59 T C 7: 41,661,299 (GRCm39) R839G probably damaging Het
Vmn2r6 A G 3: 64,445,724 (GRCm39) L667P probably damaging Het
Vmn2r91 T A 17: 18,356,305 (GRCm39) F657L possibly damaging Het
Vps13d A G 4: 144,824,701 (GRCm39) V2923A Het
Xylb T A 9: 119,201,022 (GRCm39) L220Q probably damaging Het
Zbtb10 C T 3: 9,316,473 (GRCm39) T95M probably benign Het
Zfp263 C T 16: 3,567,482 (GRCm39) P599L probably damaging Het
Zfp532 A G 18: 65,789,639 (GRCm39) E1026G probably benign Het
Zfp78 A G 7: 6,382,078 (GRCm39) N376S probably benign Het
Other mutations in Trpm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Trpm1 APN 7 63,893,198 (GRCm39) missense probably damaging 1.00
IGL00465:Trpm1 APN 7 63,897,215 (GRCm39) missense possibly damaging 0.94
IGL01118:Trpm1 APN 7 63,885,572 (GRCm39) missense probably benign 0.24
IGL01148:Trpm1 APN 7 63,893,312 (GRCm39) missense probably damaging 1.00
IGL01303:Trpm1 APN 7 63,860,578 (GRCm39) critical splice acceptor site probably benign 0.00
IGL01432:Trpm1 APN 7 63,884,767 (GRCm39) missense probably benign 0.18
IGL01433:Trpm1 APN 7 63,854,276 (GRCm39) missense probably damaging 1.00
IGL01506:Trpm1 APN 7 63,893,329 (GRCm39) missense probably damaging 1.00
IGL01626:Trpm1 APN 7 63,918,637 (GRCm39) missense probably damaging 1.00
IGL01640:Trpm1 APN 7 63,876,645 (GRCm39) missense probably damaging 1.00
IGL01899:Trpm1 APN 7 63,884,742 (GRCm39) missense probably benign 0.24
IGL01959:Trpm1 APN 7 63,858,723 (GRCm39) missense possibly damaging 0.81
IGL02210:Trpm1 APN 7 63,860,613 (GRCm39) missense probably damaging 1.00
IGL02268:Trpm1 APN 7 63,867,362 (GRCm39) missense probably damaging 0.96
IGL02331:Trpm1 APN 7 63,884,800 (GRCm39) missense probably benign 0.30
IGL02334:Trpm1 APN 7 63,895,690 (GRCm39) critical splice acceptor site probably null
IGL02407:Trpm1 APN 7 63,868,869 (GRCm39) missense probably damaging 1.00
IGL02425:Trpm1 APN 7 63,890,175 (GRCm39) missense probably damaging 0.96
IGL02485:Trpm1 APN 7 63,918,862 (GRCm39) missense possibly damaging 0.52
IGL02635:Trpm1 APN 7 63,848,972 (GRCm39) missense probably benign 0.00
IGL02640:Trpm1 APN 7 63,868,881 (GRCm39) missense probably damaging 0.97
IGL02827:Trpm1 APN 7 63,868,908 (GRCm39) missense probably null 1.00
PIT4458001:Trpm1 UTSW 7 63,918,309 (GRCm39) missense possibly damaging 0.94
PIT4544001:Trpm1 UTSW 7 63,848,998 (GRCm39) intron probably benign
R0012:Trpm1 UTSW 7 63,918,339 (GRCm39) missense possibly damaging 0.88
R0014:Trpm1 UTSW 7 63,897,970 (GRCm39) missense probably damaging 1.00
R0056:Trpm1 UTSW 7 63,893,334 (GRCm39) missense probably damaging 1.00
R0445:Trpm1 UTSW 7 63,894,590 (GRCm39) unclassified probably benign
R0463:Trpm1 UTSW 7 63,870,002 (GRCm39) missense probably benign 0.05
R0469:Trpm1 UTSW 7 63,873,506 (GRCm39) missense probably damaging 1.00
R0510:Trpm1 UTSW 7 63,873,506 (GRCm39) missense probably damaging 1.00
R1301:Trpm1 UTSW 7 63,852,801 (GRCm39) splice site probably null
R1397:Trpm1 UTSW 7 63,867,406 (GRCm39) missense probably damaging 1.00
R1588:Trpm1 UTSW 7 63,873,565 (GRCm39) missense possibly damaging 0.93
R1618:Trpm1 UTSW 7 63,890,283 (GRCm39) missense probably damaging 1.00
R1724:Trpm1 UTSW 7 63,885,569 (GRCm39) nonsense probably null
R1827:Trpm1 UTSW 7 63,884,755 (GRCm39) missense probably damaging 1.00
R1829:Trpm1 UTSW 7 63,876,530 (GRCm39) missense probably damaging 1.00
R1835:Trpm1 UTSW 7 63,880,016 (GRCm39) missense probably damaging 1.00
R1864:Trpm1 UTSW 7 63,917,764 (GRCm39) missense probably damaging 1.00
R1895:Trpm1 UTSW 7 63,873,556 (GRCm39) missense probably damaging 1.00
R1946:Trpm1 UTSW 7 63,873,556 (GRCm39) missense probably damaging 1.00
R1959:Trpm1 UTSW 7 63,879,978 (GRCm39) missense probably damaging 1.00
R1960:Trpm1 UTSW 7 63,879,978 (GRCm39) missense probably damaging 1.00
R1980:Trpm1 UTSW 7 63,858,182 (GRCm39) missense possibly damaging 0.83
R1989:Trpm1 UTSW 7 63,858,780 (GRCm39) intron probably null
R2054:Trpm1 UTSW 7 63,890,303 (GRCm39) missense possibly damaging 0.69
R2156:Trpm1 UTSW 7 63,884,736 (GRCm39) missense probably damaging 1.00
R2251:Trpm1 UTSW 7 63,859,724 (GRCm39) missense probably damaging 1.00
R3051:Trpm1 UTSW 7 63,918,849 (GRCm39) missense probably damaging 1.00
R3148:Trpm1 UTSW 7 63,884,760 (GRCm39) missense probably benign 0.00
R3195:Trpm1 UTSW 7 63,849,061 (GRCm39) nonsense probably null
R3615:Trpm1 UTSW 7 63,893,318 (GRCm39) missense probably damaging 1.00
R3616:Trpm1 UTSW 7 63,893,318 (GRCm39) missense probably damaging 1.00
R3623:Trpm1 UTSW 7 63,894,601 (GRCm39) missense probably damaging 1.00
R3624:Trpm1 UTSW 7 63,894,601 (GRCm39) missense probably damaging 1.00
R3721:Trpm1 UTSW 7 63,867,475 (GRCm39) intron probably benign
R3822:Trpm1 UTSW 7 63,867,451 (GRCm39) intron probably benign
R4441:Trpm1 UTSW 7 63,851,666 (GRCm39) missense probably damaging 1.00
R4490:Trpm1 UTSW 7 63,858,660 (GRCm39) nonsense probably null
R4666:Trpm1 UTSW 7 63,852,782 (GRCm39) missense probably damaging 1.00
R4701:Trpm1 UTSW 7 63,893,248 (GRCm39) missense probably damaging 1.00
R4781:Trpm1 UTSW 7 63,884,800 (GRCm39) missense probably benign 0.30
R4811:Trpm1 UTSW 7 63,858,054 (GRCm39) missense probably damaging 1.00
R5017:Trpm1 UTSW 7 63,894,580 (GRCm39) unclassified probably benign
R5030:Trpm1 UTSW 7 63,885,579 (GRCm39) missense probably damaging 1.00
R5195:Trpm1 UTSW 7 63,887,441 (GRCm39) missense possibly damaging 0.84
R5238:Trpm1 UTSW 7 63,918,702 (GRCm39) missense probably damaging 1.00
R5304:Trpm1 UTSW 7 63,858,694 (GRCm39) missense probably benign 0.00
R5575:Trpm1 UTSW 7 63,870,018 (GRCm39) missense possibly damaging 0.95
R5613:Trpm1 UTSW 7 63,858,159 (GRCm39) missense probably damaging 1.00
R5855:Trpm1 UTSW 7 63,918,710 (GRCm39) nonsense probably null
R5947:Trpm1 UTSW 7 63,873,547 (GRCm39) missense probably benign 0.07
R5988:Trpm1 UTSW 7 63,876,553 (GRCm39) missense probably benign 0.16
R6054:Trpm1 UTSW 7 63,918,450 (GRCm39) missense probably benign 0.00
R6088:Trpm1 UTSW 7 63,917,724 (GRCm39) missense probably damaging 0.98
R6259:Trpm1 UTSW 7 63,918,226 (GRCm39) missense possibly damaging 0.47
R6379:Trpm1 UTSW 7 63,848,942 (GRCm39) missense probably benign 0.00
R6380:Trpm1 UTSW 7 63,918,045 (GRCm39) missense probably benign 0.24
R6429:Trpm1 UTSW 7 63,918,252 (GRCm39) missense probably benign 0.00
R6600:Trpm1 UTSW 7 63,803,781 (GRCm39) start codon destroyed probably null 0.56
R6622:Trpm1 UTSW 7 63,890,343 (GRCm39) missense probably damaging 0.96
R6939:Trpm1 UTSW 7 63,918,045 (GRCm39) missense probably benign 0.03
R6944:Trpm1 UTSW 7 63,893,181 (GRCm39) missense probably damaging 1.00
R7025:Trpm1 UTSW 7 63,876,462 (GRCm39) critical splice acceptor site probably null
R7112:Trpm1 UTSW 7 63,885,593 (GRCm39) missense probably damaging 0.97
R7168:Trpm1 UTSW 7 63,918,445 (GRCm39) missense probably benign 0.01
R7219:Trpm1 UTSW 7 63,854,333 (GRCm39) missense possibly damaging 0.68
R7224:Trpm1 UTSW 7 63,868,854 (GRCm39) critical splice acceptor site probably null
R7285:Trpm1 UTSW 7 63,859,729 (GRCm39) nonsense probably null
R7367:Trpm1 UTSW 7 63,918,549 (GRCm39) missense probably benign 0.06
R7449:Trpm1 UTSW 7 63,858,723 (GRCm39) missense probably benign 0.14
R7466:Trpm1 UTSW 7 63,890,330 (GRCm39) missense probably damaging 0.99
R7498:Trpm1 UTSW 7 63,858,657 (GRCm39) missense possibly damaging 0.93
R7581:Trpm1 UTSW 7 63,854,303 (GRCm39) missense probably benign 0.00
R7776:Trpm1 UTSW 7 63,897,939 (GRCm39) missense probably benign 0.04
R8062:Trpm1 UTSW 7 63,851,689 (GRCm39) missense probably benign 0.18
R8069:Trpm1 UTSW 7 63,858,718 (GRCm39) missense possibly damaging 0.55
R8157:Trpm1 UTSW 7 63,849,017 (GRCm39) missense probably damaging 1.00
R8219:Trpm1 UTSW 7 63,851,699 (GRCm39) missense probably benign 0.35
R8258:Trpm1 UTSW 7 63,918,777 (GRCm39) missense probably benign 0.10
R8259:Trpm1 UTSW 7 63,918,777 (GRCm39) missense probably benign 0.10
R8320:Trpm1 UTSW 7 63,918,541 (GRCm39) missense possibly damaging 0.56
R8536:Trpm1 UTSW 7 63,897,155 (GRCm39) missense probably damaging 1.00
R8544:Trpm1 UTSW 7 63,874,356 (GRCm39) splice site probably null
R8813:Trpm1 UTSW 7 63,851,756 (GRCm39) missense possibly damaging 0.68
R8912:Trpm1 UTSW 7 63,918,628 (GRCm39) missense probably benign 0.06
R8954:Trpm1 UTSW 7 63,858,089 (GRCm39) missense probably damaging 0.98
R9139:Trpm1 UTSW 7 63,848,943 (GRCm39) missense probably benign 0.00
R9205:Trpm1 UTSW 7 63,890,319 (GRCm39) missense possibly damaging 0.66
R9258:Trpm1 UTSW 7 63,884,713 (GRCm39) missense probably benign 0.01
R9283:Trpm1 UTSW 7 63,873,623 (GRCm39) missense probably benign 0.18
R9394:Trpm1 UTSW 7 63,918,480 (GRCm39) missense probably benign 0.00
R9430:Trpm1 UTSW 7 63,873,446 (GRCm39) missense probably benign 0.38
R9537:Trpm1 UTSW 7 63,803,616 (GRCm39) unclassified probably benign
R9774:Trpm1 UTSW 7 63,898,041 (GRCm39) missense possibly damaging 0.90
X0026:Trpm1 UTSW 7 63,918,658 (GRCm39) missense probably benign 0.05
Z1176:Trpm1 UTSW 7 63,854,342 (GRCm39) critical splice donor site probably null
Z1176:Trpm1 UTSW 7 63,852,879 (GRCm39) critical splice donor site probably null
Z1177:Trpm1 UTSW 7 63,867,439 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- CGAAGCATTGGTCAACATTAGC -3'
(R):5'- AGCTCCTGGGCATTCTCATG -3'

Sequencing Primer
(F):5'- TGGTCAACATTAGCACTACAAGG -3'
(R):5'- CATTCTCATGCTGATCTCGGGAG -3'
Posted On 2022-09-12