Incidental Mutation 'R9616:Brca1'
ID 724604
Institutional Source Beutler Lab
Gene Symbol Brca1
Ensembl Gene ENSMUSG00000017146
Gene Name breast cancer 1, early onset
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9616 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 101488764-101551955 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 101525857 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Lysine at position 484 (E484K)
Ref Sequence ENSEMBL: ENSMUSP00000017290 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017290] [ENSMUST00000142086] [ENSMUST00000191198]
AlphaFold P48754
Predicted Effect probably damaging
Transcript: ENSMUST00000017290
AA Change: E484K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000017290
Gene: ENSMUSG00000017146
AA Change: E484K

DomainStartEndE-ValueType
RING 24 64 1.82e-7 SMART
Pfam:BRCT_assoc 342 503 2.6e-69 PFAM
low complexity region 1173 1185 N/A INTRINSIC
Blast:BRCT 1343 1406 2e-16 BLAST
low complexity region 1555 1575 N/A INTRINSIC
BRCT 1587 1669 3.87e-11 SMART
BRCT 1700 1787 3.42e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000142086
SMART Domains Protein: ENSMUSP00000139813
Gene: ENSMUSG00000017146

DomainStartEndE-ValueType
RING 24 64 8.6e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000191198
SMART Domains Protein: ENSMUSP00000139737
Gene: ENSMUSG00000017146

DomainStartEndE-ValueType
Pfam:EIN3 1 146 3.5e-18 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear phosphoprotein that plays a role in maintaining genomic stability, and it also acts as a tumor suppressor. The encoded protein combines with other tumor suppressors, DNA damage sensors, and signal transducers to form a large multi-subunit protein complex known as the BRCA1-associated genome surveillance complex (BASC). This gene product associates with RNA polymerase II, and through the C-terminal domain, also interacts with histone deacetylase complexes. This protein thus plays a role in transcription, DNA repair of double-stranded breaks, and recombination. Mutations in this gene are responsible for approximately 40% of inherited breast cancers and more than 80% of inherited breast and ovarian cancers. Alternative splicing plays a role in modulating the subcellular localization and physiological function of this gene. Many alternatively spliced transcript variants, some of which are disease-associated mutations, have been described for this gene, but the full-length natures of only some of these variants has been described. A related pseudogene, which is also located on chromosome 17, has been identified. [provided by RefSeq, May 2009]
PHENOTYPE: Homozygous null mutants are embryonic lethal with abnormalities including growth retardation, neural tube defects, and mesoderm abnormalities; conditional mutations cause genetic instability and enhanced tumor formation; mutants with truncated BRCA1 protein survive, have a kinky tail, pigmentation anomalies, male infertility and increased tumor incidence. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110040M04Rik T A 1: 151,204,729 D189E probably benign Het
Abca13 A T 11: 9,290,501 H788L probably benign Het
Abcb1b A G 5: 8,812,779 I154V probably benign Het
Acsm4 A G 7: 119,694,649 N81S probably benign Het
Adamts5 G A 16: 85,862,786 H873Y probably benign Het
Aox4 C T 1: 58,228,861 T200I possibly damaging Het
Arhgap33 A G 7: 30,529,942 V336A probably damaging Het
Capn13 T A 17: 73,365,969 D113V probably benign Het
Catsper2 TAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCT TAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCT 2: 121,397,572 probably benign Het
Ceacam3 G A 7: 17,158,153 E274K Het
Cfh A T 1: 140,102,516 I891K probably damaging Het
Cgn A G 3: 94,763,025 S1041P probably damaging Het
Cldn18 T C 9: 99,698,862 D111G probably benign Het
Cnp G A 11: 100,576,435 R68Q probably benign Het
Cntn4 T A 6: 106,697,564 C1008* probably null Het
Cntnap5a T C 1: 116,101,593 I259T probably benign Het
Cubn A G 2: 13,314,718 I2897T probably benign Het
Cyp2c39 T A 19: 39,513,204 L67Q probably damaging Het
Dclk1 G A 3: 55,480,433 C100Y probably damaging Het
Ddc C T 11: 11,822,288 W349* probably null Het
Dennd3 A G 15: 73,568,714 E1198G probably benign Het
Dnah1 T C 14: 31,304,443 D826G probably null Het
Dpp4 T C 2: 62,387,085 Y56C probably damaging Het
Etv6 A G 6: 134,266,332 D350G possibly damaging Het
Fam129a T C 1: 151,636,442 Y32H probably damaging Het
Fat1 C A 8: 44,953,038 P942Q probably damaging Het
Fbxl5 A G 5: 43,758,817 F418L probably benign Het
Fbxo11 T A 17: 88,008,670 H368L Het
Fhl2 G T 1: 43,128,386 H182Q probably damaging Het
Gabpa T A 16: 84,852,573 C223S probably damaging Het
Gigyf2 T C 1: 87,428,604 I803T unknown Het
Greb1 A T 12: 16,740,037 N3K probably damaging Het
Hmcn1 T G 1: 150,808,722 S366R probably benign Het
Il17b A G 18: 61,692,292 Q133R probably benign Het
Inha T A 1: 75,509,567 S169T probably benign Het
Itsn1 G A 16: 91,853,167 R243H probably benign Het
Kcnu1 G GA 8: 25,913,647 probably null Het
Kdm1b A G 13: 47,080,554 E788G probably damaging Het
Kdm2a A T 19: 4,320,280 I1059N probably damaging Het
Klk1b9 G T 7: 43,979,371 G100C probably benign Het
Knl1 T C 2: 119,069,513 V565A probably benign Het
Knl1 A T 2: 119,076,944 N1650Y probably damaging Het
Lpp T C 16: 24,761,969 V270A probably benign Het
Lrrc15 A G 16: 30,273,699 L274P probably damaging Het
Mertk C T 2: 128,801,335 L885F probably benign Het
Mpst T A 15: 78,410,161 L31* probably null Het
Ms4a10 T C 19: 10,967,076 T115A possibly damaging Het
Myof A G 19: 37,934,815 I1330T possibly damaging Het
Ncam2 T C 16: 81,443,254 I201T probably damaging Het
Nefh T A 11: 4,939,443 K1059* probably null Het
Nek1 T C 8: 61,020,073 Y168H probably damaging Het
Nek11 T A 9: 105,204,812 T531S probably damaging Het
Nelfa G A 5: 33,901,783 P243S possibly damaging Het
Notum G T 11: 120,660,148 T64K Het
Olfr1504 A G 19: 13,887,497 S238P probably damaging Het
Olfr159 T A 4: 43,770,193 K273* probably null Het
Olfr691 A C 7: 105,337,313 Y134* probably null Het
Otof A G 5: 30,382,364 I1035T possibly damaging Het
Otud3 A G 4: 138,897,614 Y259H probably benign Het
Per1 G T 11: 69,102,728 C368F probably damaging Het
Pitrm1 G T 13: 6,555,566 R183L probably damaging Het
Prl3a1 C T 13: 27,275,135 A119V Het
Pycard C T 7: 127,993,604 G17E probably benign Het
Rnf13 A G 3: 57,833,009 D249G possibly damaging Het
Sdhaf2 T C 19: 10,517,325 Y33C probably damaging Het
Sdk2 A G 11: 113,800,235 V1838A probably benign Het
Sgo2b C T 8: 63,927,240 V853I probably benign Het
Slc1a4 T C 11: 20,332,403 T24A probably benign Het
Slc8a1 T C 17: 81,647,978 T544A probably benign Het
Sntg2 T C 12: 30,276,733 N143S probably benign Het
Sphkap T C 1: 83,277,268 E920G probably damaging Het
Srgap2 T A 1: 131,325,090 H132L Het
Srgap3 A T 6: 112,771,563 V376D probably damaging Het
Stxbp5l T C 16: 37,215,952 K434E probably damaging Het
Tab2 A T 10: 7,919,241 N492K possibly damaging Het
Tbc1d32 T C 10: 56,161,150 Q666R possibly damaging Het
Tekt4 T C 17: 25,473,808 probably null Het
Tnni3k G A 3: 154,962,087 Q230* probably null Het
Trp53bp1 A C 2: 121,236,176 S690A probably benign Het
Trpa1 C A 1: 14,918,853 probably benign Het
Trpm1 T G 7: 64,208,384 V324G probably damaging Het
Usp29 A G 7: 6,963,180 E674G possibly damaging Het
Vmn2r59 T C 7: 42,011,875 R839G probably damaging Het
Vmn2r6 A G 3: 64,538,303 L667P probably damaging Het
Vmn2r91 T A 17: 18,136,043 F657L possibly damaging Het
Vps13d A G 4: 145,098,131 V2923A Het
Xylb T A 9: 119,371,956 L220Q probably damaging Het
Zbtb10 C T 3: 9,251,413 T95M probably benign Het
Zfp263 C T 16: 3,749,618 P599L probably damaging Het
Zfp532 A G 18: 65,656,568 E1026G probably benign Het
Zfp78 A G 7: 6,379,079 N376S probably benign Het
Other mutations in Brca1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01095:Brca1 APN 11 101524369 missense possibly damaging 0.71
IGL01598:Brca1 APN 11 101524330 missense probably benign 0.04
IGL01744:Brca1 APN 11 101524176 missense possibly damaging 0.73
IGL02128:Brca1 APN 11 101530982 unclassified probably benign
IGL02377:Brca1 APN 11 101524323 missense probably benign 0.01
IGL02701:Brca1 APN 11 101525235 missense probably damaging 1.00
IGL02732:Brca1 APN 11 101492219 missense probably benign 0.07
IGL02935:Brca1 APN 11 101489867 missense probably benign 0.00
IGL02940:Brca1 APN 11 101489912 missense probably benign 0.00
IGL03198:Brca1 APN 11 101512711 splice site probably benign
BB002:Brca1 UTSW 11 101508146 missense probably benign 0.01
BB009:Brca1 UTSW 11 101540017 missense possibly damaging 0.85
BB012:Brca1 UTSW 11 101508146 missense probably benign 0.01
BB019:Brca1 UTSW 11 101540017 missense possibly damaging 0.85
PIT4142001:Brca1 UTSW 11 101522422 unclassified probably benign
R0048:Brca1 UTSW 11 101524977 missense possibly damaging 0.94
R0048:Brca1 UTSW 11 101524977 missense possibly damaging 0.94
R0109:Brca1 UTSW 11 101531090 missense possibly damaging 0.85
R0109:Brca1 UTSW 11 101531090 missense possibly damaging 0.85
R0144:Brca1 UTSW 11 101526121 missense probably damaging 1.00
R0336:Brca1 UTSW 11 101523993 missense probably benign 0.04
R0448:Brca1 UTSW 11 101508221 missense possibly damaging 0.93
R0595:Brca1 UTSW 11 101524887 missense probably benign 0.27
R0613:Brca1 UTSW 11 101508210 missense probably benign 0.18
R0863:Brca1 UTSW 11 101524770 missense probably benign 0.36
R0940:Brca1 UTSW 11 101532143 missense possibly damaging 0.73
R0962:Brca1 UTSW 11 101525366 missense possibly damaging 0.46
R1365:Brca1 UTSW 11 101501996 missense probably benign
R1391:Brca1 UTSW 11 101526546 missense possibly damaging 0.53
R1467:Brca1 UTSW 11 101531107 unclassified probably benign
R1484:Brca1 UTSW 11 101529812 missense possibly damaging 0.86
R1530:Brca1 UTSW 11 101524695 missense probably damaging 1.00
R1645:Brca1 UTSW 11 101510053 missense probably benign 0.00
R1682:Brca1 UTSW 11 101525565 missense probably damaging 0.98
R1687:Brca1 UTSW 11 101489840 missense probably benign
R1694:Brca1 UTSW 11 101532099 missense probably damaging 0.98
R1695:Brca1 UTSW 11 101524455 missense probably damaging 0.97
R1762:Brca1 UTSW 11 101532018 critical splice donor site probably null
R1868:Brca1 UTSW 11 101498013 missense probably benign
R1973:Brca1 UTSW 11 101526403 missense probably benign 0.22
R2034:Brca1 UTSW 11 101489849 missense probably benign
R2106:Brca1 UTSW 11 101524977 missense possibly damaging 0.94
R4089:Brca1 UTSW 11 101524176 missense possibly damaging 0.73
R4194:Brca1 UTSW 11 101525287 missense probably benign 0.02
R4571:Brca1 UTSW 11 101517366 missense probably benign 0.00
R4735:Brca1 UTSW 11 101492175 splice site probably null
R4789:Brca1 UTSW 11 101523932 missense probably benign 0.00
R4920:Brca1 UTSW 11 101524959 missense probably damaging 1.00
R4939:Brca1 UTSW 11 101508050 missense probably benign
R4997:Brca1 UTSW 11 101524333 missense probably damaging 0.96
R5458:Brca1 UTSW 11 101517285 missense possibly damaging 0.53
R5778:Brca1 UTSW 11 101525301 missense possibly damaging 0.47
R6051:Brca1 UTSW 11 101524246 missense probably damaging 1.00
R6505:Brca1 UTSW 11 101523541 missense probably benign 0.03
R6548:Brca1 UTSW 11 101524765 missense probably damaging 1.00
R6971:Brca1 UTSW 11 101534005 missense probably benign 0.18
R7091:Brca1 UTSW 11 101526427 missense probably benign 0.00
R7246:Brca1 UTSW 11 101523378 missense probably benign 0.00
R7417:Brca1 UTSW 11 101524981 missense probably damaging 1.00
R7861:Brca1 UTSW 11 101526422 missense possibly damaging 0.87
R7925:Brca1 UTSW 11 101508146 missense probably benign 0.01
R7932:Brca1 UTSW 11 101540017 missense possibly damaging 0.85
R8003:Brca1 UTSW 11 101524477 missense probably benign 0.22
R8046:Brca1 UTSW 11 101525470 missense probably benign 0.03
R8306:Brca1 UTSW 11 101525637 missense probably damaging 1.00
R8483:Brca1 UTSW 11 101525976 missense probably damaging 0.99
R8685:Brca1 UTSW 11 101489846 missense probably benign 0.19
R9072:Brca1 UTSW 11 101502480 critical splice donor site probably null
R9073:Brca1 UTSW 11 101502480 critical splice donor site probably null
R9486:Brca1 UTSW 11 101523694 missense probably benign 0.00
R9505:Brca1 UTSW 11 101512766 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGGTAGTACTCACTGCTTGC -3'
(R):5'- GCACGAGTCAAATGCTGAAGC -3'

Sequencing Primer
(F):5'- GCTCATTTGGCTCCATTAGGTCAG -3'
(R):5'- GGGGTTTTAGTTCTTCAAGGAAAAC -3'
Posted On 2022-09-12