Mutagenetix > Incidental Mutation

Incidental Mutation 'R9616:Brca1'

724604

Institutional Source

Beutler Lab

Gene Symbol

Brca1

Ensembl Gene

ENSMUSG00000017146

Gene Name

breast cancer 1, early onset

Synonyms

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R9616 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

101488764-101551955 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 101525857 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Lysine at position 484 (E484K)

Ref Sequence

ENSEMBL: ENSMUSP00000017290 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000017290] [ENSMUST00000142086] [ENSMUST00000191198]

AlphaFold

P48754

Predicted Effect

probably damaging
Transcript: ENSMUST00000017290
AA Change: E484K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000017290
Gene: ENSMUSG00000017146
AA Change: E484K

Domain	Start	End	E-Value	Type
RING	24	64	1.82e-7	SMART
Pfam:BRCT_assoc	342	503	2.6e-69	PFAM
low complexity region	1173	1185	N/A	INTRINSIC
Blast:BRCT	1343	1406	2e-16	BLAST
low complexity region	1555	1575	N/A	INTRINSIC
BRCT	1587	1669	3.87e-11	SMART
BRCT	1700	1787	3.42e-12	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000142086

SMART Domains

Protein: ENSMUSP00000139813
Gene: ENSMUSG00000017146

Domain	Start	End	E-Value	Type
RING	24	64	8.6e-10	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000191198

SMART Domains

Protein: ENSMUSP00000139737
Gene: ENSMUSG00000017146

Domain	Start	End	E-Value	Type
Pfam:EIN3	1	146	3.5e-18	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 99.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear phosphoprotein that plays a role in maintaining genomic stability, and it also acts as a tumor suppressor. The encoded protein combines with other tumor suppressors, DNA damage sensors, and signal transducers to form a large multi-subunit protein complex known as the BRCA1-associated genome surveillance complex (BASC). This gene product associates with RNA polymerase II, and through the C-terminal domain, also interacts with histone deacetylase complexes. This protein thus plays a role in transcription, DNA repair of double-stranded breaks, and recombination. Mutations in this gene are responsible for approximately 40% of inherited breast cancers and more than 80% of inherited breast and ovarian cancers. Alternative splicing plays a role in modulating the subcellular localization and physiological function of this gene. Many alternatively spliced transcript variants, some of which are disease-associated mutations, have been described for this gene, but the full-length natures of only some of these variants has been described. A related pseudogene, which is also located on chromosome 17, has been identified. [provided by RefSeq, May 2009]
PHENOTYPE: Homozygous null mutants are embryonic lethal with abnormalities including growth retardation, neural tube defects, and mesoderm abnormalities; conditional mutations cause genetic instability and enhanced tumor formation; mutants with truncated BRCA1 protein survive, have a kinky tail, pigmentation anomalies, male infertility and increased tumor incidence. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 91 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3110040M04Rik	T	A	1: 151,204,729	D189E	probably benign	Het
Abca13	A	T	11: 9,290,501	H788L	probably benign	Het
Abcb1b	A	G	5: 8,812,779	I154V	probably benign	Het
Acsm4	A	G	7: 119,694,649	N81S	probably benign	Het
Adamts5	G	A	16: 85,862,786	H873Y	probably benign	Het
Aox4	C	T	1: 58,228,861	T200I	possibly damaging	Het
Arhgap33	A	G	7: 30,529,942	V336A	probably damaging	Het
Capn13	T	A	17: 73,365,969	D113V	probably benign	Het
Catsper2	TAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCT	TAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCT	2: 121,397,572		probably benign	Het
Ceacam3	G	A	7: 17,158,153	E274K		Het
Cfh	A	T	1: 140,102,516	I891K	probably damaging	Het
Cgn	A	G	3: 94,763,025	S1041P	probably damaging	Het
Cldn18	T	C	9: 99,698,862	D111G	probably benign	Het
Cnp	G	A	11: 100,576,435	R68Q	probably benign	Het
Cntn4	T	A	6: 106,697,564	C1008*	probably null	Het
Cntnap5a	T	C	1: 116,101,593	I259T	probably benign	Het
Cubn	A	G	2: 13,314,718	I2897T	probably benign	Het
Cyp2c39	T	A	19: 39,513,204	L67Q	probably damaging	Het
Dclk1	G	A	3: 55,480,433	C100Y	probably damaging	Het
Ddc	C	T	11: 11,822,288	W349*	probably null	Het
Dennd3	A	G	15: 73,568,714	E1198G	probably benign	Het
Dnah1	T	C	14: 31,304,443	D826G	probably null	Het
Dpp4	T	C	2: 62,387,085	Y56C	probably damaging	Het
Etv6	A	G	6: 134,266,332	D350G	possibly damaging	Het
Fam129a	T	C	1: 151,636,442	Y32H	probably damaging	Het
Fat1	C	A	8: 44,953,038	P942Q	probably damaging	Het
Fbxl5	A	G	5: 43,758,817	F418L	probably benign	Het
Fbxo11	T	A	17: 88,008,670	H368L		Het
Fhl2	G	T	1: 43,128,386	H182Q	probably damaging	Het
Gabpa	T	A	16: 84,852,573	C223S	probably damaging	Het
Gigyf2	T	C	1: 87,428,604	I803T	unknown	Het
Greb1	A	T	12: 16,740,037	N3K	probably damaging	Het
Hmcn1	T	G	1: 150,808,722	S366R	probably benign	Het
Il17b	A	G	18: 61,692,292	Q133R	probably benign	Het
Inha	T	A	1: 75,509,567	S169T	probably benign	Het
Itsn1	G	A	16: 91,853,167	R243H	probably benign	Het
Kcnu1	G	GA	8: 25,913,647		probably null	Het
Kdm1b	A	G	13: 47,080,554	E788G	probably damaging	Het
Kdm2a	A	T	19: 4,320,280	I1059N	probably damaging	Het
Klk1b9	G	T	7: 43,979,371	G100C	probably benign	Het
Knl1	T	C	2: 119,069,513	V565A	probably benign	Het
Knl1	A	T	2: 119,076,944	N1650Y	probably damaging	Het
Lpp	T	C	16: 24,761,969	V270A	probably benign	Het
Lrrc15	A	G	16: 30,273,699	L274P	probably damaging	Het
Mertk	C	T	2: 128,801,335	L885F	probably benign	Het
Mpst	T	A	15: 78,410,161	L31*	probably null	Het
Ms4a10	T	C	19: 10,967,076	T115A	possibly damaging	Het
Myof	A	G	19: 37,934,815	I1330T	possibly damaging	Het
Ncam2	T	C	16: 81,443,254	I201T	probably damaging	Het
Nefh	T	A	11: 4,939,443	K1059*	probably null	Het
Nek1	T	C	8: 61,020,073	Y168H	probably damaging	Het
Nek11	T	A	9: 105,204,812	T531S	probably damaging	Het
Nelfa	G	A	5: 33,901,783	P243S	possibly damaging	Het
Notum	G	T	11: 120,660,148	T64K		Het
Olfr1504	A	G	19: 13,887,497	S238P	probably damaging	Het
Olfr159	T	A	4: 43,770,193	K273*	probably null	Het
Olfr691	A	C	7: 105,337,313	Y134*	probably null	Het
Otof	A	G	5: 30,382,364	I1035T	possibly damaging	Het
Otud3	A	G	4: 138,897,614	Y259H	probably benign	Het
Per1	G	T	11: 69,102,728	C368F	probably damaging	Het
Pitrm1	G	T	13: 6,555,566	R183L	probably damaging	Het
Prl3a1	C	T	13: 27,275,135	A119V		Het
Pycard	C	T	7: 127,993,604	G17E	probably benign	Het
Rnf13	A	G	3: 57,833,009	D249G	possibly damaging	Het
Sdhaf2	T	C	19: 10,517,325	Y33C	probably damaging	Het
Sdk2	A	G	11: 113,800,235	V1838A	probably benign	Het
Sgo2b	C	T	8: 63,927,240	V853I	probably benign	Het
Slc1a4	T	C	11: 20,332,403	T24A	probably benign	Het
Slc8a1	T	C	17: 81,647,978	T544A	probably benign	Het
Sntg2	T	C	12: 30,276,733	N143S	probably benign	Het
Sphkap	T	C	1: 83,277,268	E920G	probably damaging	Het
Srgap2	T	A	1: 131,325,090	H132L		Het
Srgap3	A	T	6: 112,771,563	V376D	probably damaging	Het
Stxbp5l	T	C	16: 37,215,952	K434E	probably damaging	Het
Tab2	A	T	10: 7,919,241	N492K	possibly damaging	Het
Tbc1d32	T	C	10: 56,161,150	Q666R	possibly damaging	Het
Tekt4	T	C	17: 25,473,808		probably null	Het
Tnni3k	G	A	3: 154,962,087	Q230*	probably null	Het
Trp53bp1	A	C	2: 121,236,176	S690A	probably benign	Het
Trpa1	C	A	1: 14,918,853		probably benign	Het
Trpm1	T	G	7: 64,208,384	V324G	probably damaging	Het
Usp29	A	G	7: 6,963,180	E674G	possibly damaging	Het
Vmn2r59	T	C	7: 42,011,875	R839G	probably damaging	Het
Vmn2r6	A	G	3: 64,538,303	L667P	probably damaging	Het
Vmn2r91	T	A	17: 18,136,043	F657L	possibly damaging	Het
Vps13d	A	G	4: 145,098,131	V2923A		Het
Xylb	T	A	9: 119,371,956	L220Q	probably damaging	Het
Zbtb10	C	T	3: 9,251,413	T95M	probably benign	Het
Zfp263	C	T	16: 3,749,618	P599L	probably damaging	Het
Zfp532	A	G	18: 65,656,568	E1026G	probably benign	Het
Zfp78	A	G	7: 6,379,079	N376S	probably benign	Het

Other mutations in Brca1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01095:Brca1	APN	11	101524369	missense	possibly damaging	0.71
IGL01598:Brca1	APN	11	101524330	missense	probably benign	0.04
IGL01744:Brca1	APN	11	101524176	missense	possibly damaging	0.73
IGL02128:Brca1	APN	11	101530982	unclassified	probably benign
IGL02377:Brca1	APN	11	101524323	missense	probably benign	0.01
IGL02701:Brca1	APN	11	101525235	missense	probably damaging	1.00
IGL02732:Brca1	APN	11	101492219	missense	probably benign	0.07
IGL02935:Brca1	APN	11	101489867	missense	probably benign	0.00
IGL02940:Brca1	APN	11	101489912	missense	probably benign	0.00
IGL03198:Brca1	APN	11	101512711	splice site	probably benign
BB002:Brca1	UTSW	11	101508146	missense	probably benign	0.01
BB009:Brca1	UTSW	11	101540017	missense	possibly damaging	0.85
BB012:Brca1	UTSW	11	101508146	missense	probably benign	0.01
BB019:Brca1	UTSW	11	101540017	missense	possibly damaging	0.85
PIT4142001:Brca1	UTSW	11	101522422	unclassified	probably benign
R0048:Brca1	UTSW	11	101524977	missense	possibly damaging	0.94
R0048:Brca1	UTSW	11	101524977	missense	possibly damaging	0.94
R0109:Brca1	UTSW	11	101531090	missense	possibly damaging	0.85
R0109:Brca1	UTSW	11	101531090	missense	possibly damaging	0.85
R0144:Brca1	UTSW	11	101526121	missense	probably damaging	1.00
R0336:Brca1	UTSW	11	101523993	missense	probably benign	0.04
R0448:Brca1	UTSW	11	101508221	missense	possibly damaging	0.93
R0595:Brca1	UTSW	11	101524887	missense	probably benign	0.27
R0613:Brca1	UTSW	11	101508210	missense	probably benign	0.18
R0863:Brca1	UTSW	11	101524770	missense	probably benign	0.36
R0940:Brca1	UTSW	11	101532143	missense	possibly damaging	0.73
R0962:Brca1	UTSW	11	101525366	missense	possibly damaging	0.46
R1365:Brca1	UTSW	11	101501996	missense	probably benign
R1391:Brca1	UTSW	11	101526546	missense	possibly damaging	0.53
R1467:Brca1	UTSW	11	101531107	unclassified	probably benign
R1484:Brca1	UTSW	11	101529812	missense	possibly damaging	0.86
R1530:Brca1	UTSW	11	101524695	missense	probably damaging	1.00
R1645:Brca1	UTSW	11	101510053	missense	probably benign	0.00
R1682:Brca1	UTSW	11	101525565	missense	probably damaging	0.98
R1687:Brca1	UTSW	11	101489840	missense	probably benign
R1694:Brca1	UTSW	11	101532099	missense	probably damaging	0.98
R1695:Brca1	UTSW	11	101524455	missense	probably damaging	0.97
R1762:Brca1	UTSW	11	101532018	critical splice donor site	probably null
R1868:Brca1	UTSW	11	101498013	missense	probably benign
R1973:Brca1	UTSW	11	101526403	missense	probably benign	0.22
R2034:Brca1	UTSW	11	101489849	missense	probably benign
R2106:Brca1	UTSW	11	101524977	missense	possibly damaging	0.94
R4089:Brca1	UTSW	11	101524176	missense	possibly damaging	0.73
R4194:Brca1	UTSW	11	101525287	missense	probably benign	0.02
R4571:Brca1	UTSW	11	101517366	missense	probably benign	0.00
R4735:Brca1	UTSW	11	101492175	splice site	probably null
R4789:Brca1	UTSW	11	101523932	missense	probably benign	0.00
R4920:Brca1	UTSW	11	101524959	missense	probably damaging	1.00
R4939:Brca1	UTSW	11	101508050	missense	probably benign
R4997:Brca1	UTSW	11	101524333	missense	probably damaging	0.96
R5458:Brca1	UTSW	11	101517285	missense	possibly damaging	0.53
R5778:Brca1	UTSW	11	101525301	missense	possibly damaging	0.47
R6051:Brca1	UTSW	11	101524246	missense	probably damaging	1.00
R6505:Brca1	UTSW	11	101523541	missense	probably benign	0.03
R6548:Brca1	UTSW	11	101524765	missense	probably damaging	1.00
R6971:Brca1	UTSW	11	101534005	missense	probably benign	0.18
R7091:Brca1	UTSW	11	101526427	missense	probably benign	0.00
R7246:Brca1	UTSW	11	101523378	missense	probably benign	0.00
R7417:Brca1	UTSW	11	101524981	missense	probably damaging	1.00
R7861:Brca1	UTSW	11	101526422	missense	possibly damaging	0.87
R7925:Brca1	UTSW	11	101508146	missense	probably benign	0.01
R7932:Brca1	UTSW	11	101540017	missense	possibly damaging	0.85
R8003:Brca1	UTSW	11	101524477	missense	probably benign	0.22
R8046:Brca1	UTSW	11	101525470	missense	probably benign	0.03
R8306:Brca1	UTSW	11	101525637	missense	probably damaging	1.00
R8483:Brca1	UTSW	11	101525976	missense	probably damaging	0.99
R8685:Brca1	UTSW	11	101489846	missense	probably benign	0.19
R9072:Brca1	UTSW	11	101502480	critical splice donor site	probably null
R9073:Brca1	UTSW	11	101502480	critical splice donor site	probably null
R9486:Brca1	UTSW	11	101523694	missense	probably benign	0.00
R9505:Brca1	UTSW	11	101512766	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TGGTAGTACTCACTGCTTGC -3'
(R):5'- GCACGAGTCAAATGCTGAAGC -3'

Sequencing Primer
(F):5'- GCTCATTTGGCTCCATTAGGTCAG -3'
(R):5'- GGGGTTTTAGTTCTTCAAGGAAAAC -3'

Posted On

2022-09-12