Incidental Mutation 'R9616:Kdm1b'
ID 724611
Institutional Source Beutler Lab
Gene Symbol Kdm1b
Ensembl Gene ENSMUSG00000038080
Gene Name lysine (K)-specific demethylase 1B
Synonyms 4632428N09Rik, Aof1
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.534) question?
Stock # R9616 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 47043499-47085279 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 47080554 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 788 (E788G)
Ref Sequence ENSEMBL: ENSMUSP00000038373 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021807] [ENSMUST00000037025]
AlphaFold Q8CIG3
Predicted Effect probably benign
Transcript: ENSMUST00000021807
SMART Domains Protein: ENSMUSP00000021807
Gene: ENSMUSG00000021377

DomainStartEndE-ValueType
low complexity region 3 18 N/A INTRINSIC
low complexity region 31 55 N/A INTRINSIC
low complexity region 58 69 N/A INTRINSIC
SAP 153 187 2.97e-8 SMART
low complexity region 190 210 N/A INTRINSIC
low complexity region 231 315 N/A INTRINSIC
Pfam:DEK_C 327 379 3.4e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000037025
AA Change: E788G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000038373
Gene: ENSMUSG00000038080
AA Change: E788G

DomainStartEndE-ValueType
Pfam:zf-CW 138 191 2.6e-13 PFAM
low complexity region 235 253 N/A INTRINSIC
Pfam:SWIRM 286 369 6e-12 PFAM
Pfam:Pyr_redox_2 368 490 3.1e-8 PFAM
Pfam:Thi4 375 446 2.2e-10 PFAM
Pfam:FAD_binding_3 388 423 4.1e-7 PFAM
Pfam:HI0933_like 389 428 1.6e-7 PFAM
Pfam:FAD_binding_2 390 428 1.6e-6 PFAM
Pfam:Pyr_redox 390 438 8e-8 PFAM
Pfam:NAD_binding_8 393 460 1.6e-13 PFAM
Pfam:Amino_oxidase 398 824 3.7e-86 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000114999
Gene: ENSMUSG00000038080
AA Change: E404G

DomainStartEndE-ValueType
Pfam:SWIRM 3 86 1.1e-12 PFAM
Pfam:Thi4 91 163 3.5e-10 PFAM
Pfam:FAD_binding_3 105 140 3.5e-7 PFAM
Pfam:HI0933_like 106 145 1.7e-7 PFAM
Pfam:Pyr_redox_2 106 251 1.5e-10 PFAM
Pfam:FAD_binding_2 107 150 5.7e-7 PFAM
Pfam:Pyr_redox 107 158 6.4e-8 PFAM
Pfam:Pyr_redox_3 109 288 1.2e-13 PFAM
Pfam:NAD_binding_8 110 177 2.3e-13 PFAM
Pfam:Amino_oxidase 115 181 8.6e-19 PFAM
Pfam:Amino_oxidase 178 441 4.5e-63 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice of both sexes are viable, grossly normal and male mice are fertile; however, heterozygous progeny of homozygous null mothers display severe placental defects, embryonic growth impairment, neural tube defects and pericardial edema, and do not survive past E10.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110040M04Rik T A 1: 151,204,729 D189E probably benign Het
Abca13 A T 11: 9,290,501 H788L probably benign Het
Abcb1b A G 5: 8,812,779 I154V probably benign Het
Acsm4 A G 7: 119,694,649 N81S probably benign Het
Adamts5 G A 16: 85,862,786 H873Y probably benign Het
Aox4 C T 1: 58,228,861 T200I possibly damaging Het
Arhgap33 A G 7: 30,529,942 V336A probably damaging Het
Brca1 C T 11: 101,525,857 E484K probably damaging Het
Capn13 T A 17: 73,365,969 D113V probably benign Het
Catsper2 TAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCT TAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCT 2: 121,397,572 probably benign Het
Ceacam3 G A 7: 17,158,153 E274K Het
Cfh A T 1: 140,102,516 I891K probably damaging Het
Cgn A G 3: 94,763,025 S1041P probably damaging Het
Cldn18 T C 9: 99,698,862 D111G probably benign Het
Cnp G A 11: 100,576,435 R68Q probably benign Het
Cntn4 T A 6: 106,697,564 C1008* probably null Het
Cntnap5a T C 1: 116,101,593 I259T probably benign Het
Cubn A G 2: 13,314,718 I2897T probably benign Het
Cyp2c39 T A 19: 39,513,204 L67Q probably damaging Het
Dclk1 G A 3: 55,480,433 C100Y probably damaging Het
Ddc C T 11: 11,822,288 W349* probably null Het
Dennd3 A G 15: 73,568,714 E1198G probably benign Het
Dnah1 T C 14: 31,304,443 D826G probably null Het
Dpp4 T C 2: 62,387,085 Y56C probably damaging Het
Etv6 A G 6: 134,266,332 D350G possibly damaging Het
Fam129a T C 1: 151,636,442 Y32H probably damaging Het
Fat1 C A 8: 44,953,038 P942Q probably damaging Het
Fbxl5 A G 5: 43,758,817 F418L probably benign Het
Fbxo11 T A 17: 88,008,670 H368L Het
Fhl2 G T 1: 43,128,386 H182Q probably damaging Het
Gabpa T A 16: 84,852,573 C223S probably damaging Het
Gigyf2 T C 1: 87,428,604 I803T unknown Het
Greb1 A T 12: 16,740,037 N3K probably damaging Het
Hmcn1 T G 1: 150,808,722 S366R probably benign Het
Il17b A G 18: 61,692,292 Q133R probably benign Het
Inha T A 1: 75,509,567 S169T probably benign Het
Itsn1 G A 16: 91,853,167 R243H probably benign Het
Kcnu1 G GA 8: 25,913,647 probably null Het
Kdm2a A T 19: 4,320,280 I1059N probably damaging Het
Klk1b9 G T 7: 43,979,371 G100C probably benign Het
Knl1 T C 2: 119,069,513 V565A probably benign Het
Knl1 A T 2: 119,076,944 N1650Y probably damaging Het
Lpp T C 16: 24,761,969 V270A probably benign Het
Lrrc15 A G 16: 30,273,699 L274P probably damaging Het
Mertk C T 2: 128,801,335 L885F probably benign Het
Mpst T A 15: 78,410,161 L31* probably null Het
Ms4a10 T C 19: 10,967,076 T115A possibly damaging Het
Myof A G 19: 37,934,815 I1330T possibly damaging Het
Ncam2 T C 16: 81,443,254 I201T probably damaging Het
Nefh T A 11: 4,939,443 K1059* probably null Het
Nek1 T C 8: 61,020,073 Y168H probably damaging Het
Nek11 T A 9: 105,204,812 T531S probably damaging Het
Nelfa G A 5: 33,901,783 P243S possibly damaging Het
Notum G T 11: 120,660,148 T64K Het
Olfr1504 A G 19: 13,887,497 S238P probably damaging Het
Olfr159 T A 4: 43,770,193 K273* probably null Het
Olfr691 A C 7: 105,337,313 Y134* probably null Het
Otof A G 5: 30,382,364 I1035T possibly damaging Het
Otud3 A G 4: 138,897,614 Y259H probably benign Het
Per1 G T 11: 69,102,728 C368F probably damaging Het
Pitrm1 G T 13: 6,555,566 R183L probably damaging Het
Prl3a1 C T 13: 27,275,135 A119V Het
Pycard C T 7: 127,993,604 G17E probably benign Het
Rnf13 A G 3: 57,833,009 D249G possibly damaging Het
Sdhaf2 T C 19: 10,517,325 Y33C probably damaging Het
Sdk2 A G 11: 113,800,235 V1838A probably benign Het
Sgo2b C T 8: 63,927,240 V853I probably benign Het
Slc1a4 T C 11: 20,332,403 T24A probably benign Het
Slc8a1 T C 17: 81,647,978 T544A probably benign Het
Sntg2 T C 12: 30,276,733 N143S probably benign Het
Sphkap T C 1: 83,277,268 E920G probably damaging Het
Srgap2 T A 1: 131,325,090 H132L Het
Srgap3 A T 6: 112,771,563 V376D probably damaging Het
Stxbp5l T C 16: 37,215,952 K434E probably damaging Het
Tab2 A T 10: 7,919,241 N492K possibly damaging Het
Tbc1d32 T C 10: 56,161,150 Q666R possibly damaging Het
Tekt4 T C 17: 25,473,808 probably null Het
Tnni3k G A 3: 154,962,087 Q230* probably null Het
Trp53bp1 A C 2: 121,236,176 S690A probably benign Het
Trpa1 C A 1: 14,918,853 probably benign Het
Trpm1 T G 7: 64,208,384 V324G probably damaging Het
Usp29 A G 7: 6,963,180 E674G possibly damaging Het
Vmn2r59 T C 7: 42,011,875 R839G probably damaging Het
Vmn2r6 A G 3: 64,538,303 L667P probably damaging Het
Vmn2r91 T A 17: 18,136,043 F657L possibly damaging Het
Vps13d A G 4: 145,098,131 V2923A Het
Xylb T A 9: 119,371,956 L220Q probably damaging Het
Zbtb10 C T 3: 9,251,413 T95M probably benign Het
Zfp263 C T 16: 3,749,618 P599L probably damaging Het
Zfp532 A G 18: 65,656,568 E1026G probably benign Het
Zfp78 A G 7: 6,379,079 N376S probably benign Het
Other mutations in Kdm1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00587:Kdm1b APN 13 47068540 missense probably benign 0.01
IGL00924:Kdm1b APN 13 47068480 missense probably benign
IGL01553:Kdm1b APN 13 47080548 missense probably damaging 0.96
IGL01663:Kdm1b APN 13 47073737 missense probably damaging 0.99
IGL02385:Kdm1b APN 13 47068506 missense possibly damaging 0.49
IGL02505:Kdm1b APN 13 47060855 missense probably damaging 1.00
IGL02826:Kdm1b APN 13 47080467 missense probably damaging 1.00
IGL03257:Kdm1b APN 13 47049266 missense probably damaging 1.00
R0052:Kdm1b UTSW 13 47064117 missense probably damaging 1.00
R0319:Kdm1b UTSW 13 47053719 missense probably benign
R0426:Kdm1b UTSW 13 47064244 splice site probably benign
R0599:Kdm1b UTSW 13 47058810 missense possibly damaging 0.47
R0764:Kdm1b UTSW 13 47068603 missense possibly damaging 0.70
R1163:Kdm1b UTSW 13 47071922 missense probably benign 0.02
R1543:Kdm1b UTSW 13 47068521 missense probably damaging 0.99
R1584:Kdm1b UTSW 13 47064054 missense probably damaging 1.00
R1627:Kdm1b UTSW 13 47064231 critical splice donor site probably null
R1669:Kdm1b UTSW 13 47068548 missense probably damaging 1.00
R1758:Kdm1b UTSW 13 47060768 missense probably benign 0.00
R1860:Kdm1b UTSW 13 47049190 missense probably benign 0.03
R1907:Kdm1b UTSW 13 47064120 missense probably benign 0.00
R2225:Kdm1b UTSW 13 47064088 frame shift probably null
R2239:Kdm1b UTSW 13 47073755 missense probably damaging 1.00
R2271:Kdm1b UTSW 13 47064088 frame shift probably null
R2302:Kdm1b UTSW 13 47064088 frame shift probably null
R2303:Kdm1b UTSW 13 47064088 frame shift probably null
R2380:Kdm1b UTSW 13 47073755 missense probably damaging 1.00
R2442:Kdm1b UTSW 13 47062975 missense probably benign 0.32
R3022:Kdm1b UTSW 13 47063077 missense probably damaging 1.00
R3054:Kdm1b UTSW 13 47063077 missense probably damaging 1.00
R3545:Kdm1b UTSW 13 47063077 missense probably damaging 1.00
R3546:Kdm1b UTSW 13 47063077 missense probably damaging 1.00
R3548:Kdm1b UTSW 13 47063077 missense probably damaging 1.00
R4094:Kdm1b UTSW 13 47063020 missense probably damaging 1.00
R4419:Kdm1b UTSW 13 47063077 missense probably damaging 1.00
R4420:Kdm1b UTSW 13 47063077 missense probably damaging 1.00
R4502:Kdm1b UTSW 13 47063077 missense probably damaging 1.00
R4547:Kdm1b UTSW 13 47063077 missense probably damaging 1.00
R4548:Kdm1b UTSW 13 47063077 missense probably damaging 1.00
R4785:Kdm1b UTSW 13 47063077 missense probably damaging 1.00
R4793:Kdm1b UTSW 13 47063077 missense probably damaging 1.00
R4804:Kdm1b UTSW 13 47063077 missense probably damaging 1.00
R4882:Kdm1b UTSW 13 47060893 missense probably benign
R4906:Kdm1b UTSW 13 47063144 critical splice donor site probably null
R4965:Kdm1b UTSW 13 47074367 missense probably damaging 0.98
R5039:Kdm1b UTSW 13 47077486 missense probably damaging 1.00
R5098:Kdm1b UTSW 13 47062991 missense probably damaging 1.00
R5265:Kdm1b UTSW 13 47062969 missense probably benign 0.35
R5541:Kdm1b UTSW 13 47079196 missense probably damaging 1.00
R5814:Kdm1b UTSW 13 47063146 splice site probably null
R6046:Kdm1b UTSW 13 47079253 missense possibly damaging 0.92
R6798:Kdm1b UTSW 13 47068536 missense probably benign 0.00
R6903:Kdm1b UTSW 13 47074404 missense probably benign 0.00
R7831:Kdm1b UTSW 13 47050622 missense probably benign 0.17
R7973:Kdm1b UTSW 13 47077446 missense probably benign 0.00
R8181:Kdm1b UTSW 13 47051901 critical splice donor site probably null
R8248:Kdm1b UTSW 13 47071878 intron probably benign
R8821:Kdm1b UTSW 13 47064141 missense possibly damaging 0.94
R8831:Kdm1b UTSW 13 47064141 missense possibly damaging 0.94
R8842:Kdm1b UTSW 13 47078356 missense probably damaging 1.00
R8861:Kdm1b UTSW 13 47064106 missense probably benign 0.02
R8885:Kdm1b UTSW 13 47053708 nonsense probably null
R9038:Kdm1b UTSW 13 47049294 missense probably benign 0.07
R9132:Kdm1b UTSW 13 47071982 missense probably benign 0.05
R9268:Kdm1b UTSW 13 47064229 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCAGGAACCTAACAGTGAGCAG -3'
(R):5'- GTGCTAGCTTTCAGAATGGAGAG -3'

Sequencing Primer
(F):5'- CCTACGAGGGCAAGATGCTTG -3'
(R):5'- AGCTTTCAGAATGGAGAGGGCTTC -3'
Posted On 2022-09-12